CRISPR/Cas9

CRISPR stands for "Clustered regularly interspaced short palindromic repeats". They were discovered in prokaryotic DNA first in 1987 and contain short repetitions of base sequences. In the course of better sequencing techniques in the early 2000s similar sequences were found in other bacteria as well. Further research revealed that the sequences of repeats in Bacteria chromosomes is interspaced with sequences derived from viruses. So called Cas proteins (CRISPR-associated genes) encodes putative nuclease or helicase proteins. Today we know that the CRISPR-System helps bacteria to acquire a type of immune system. For a short introduction to CRISPR please visit our CRISPR resource page here.

genomics-online offers you currently more than 300,000 Cas9 enzyme products and ready-to-use plasmids for CRISPR/Cas9. Your advantages: Lower price than customized and faster results. Below you will find all of our CRISPR/Cas9 products.

Click here to visit our CRISPR-plasmid category, or here to see all of our Cas9 enzyme products. If you need help with finding the right product for your needs, our customer support will gladly help you via phone, live chat or email.

307,452 Products
Data Quality
  • 4
Type
  • 307435
  • 16
  • 1
Gene
  • 40
  • 39
  • 36
  • 36
  • 34
Species
  • 140380
  • 101913
  • 65028
  • 110
  • 4
Insert
  • 154617
  • 114972
  • 37846
Vector
  • 268291
  • 39144
Vector Backbone
  • 115473
  • 114972
  • 39144
  • 37846
Fusion tag
  • 230462
  • 39144
  • 37846
Resistance Gene
  • 307435
  • 37846
Selectable Marker
  • 153319
  • 114972
Promoter
  • 269589
  • 153319
  • 39144
Expression Type
  • 307435
  • 268291
Application
  • 935950
  • 307452
    Genome Editing with Engineered Nucleases (GEEN)
  • 277854
  • 271619
  • 9197
Supplier: Log in to see

Knockout Kit for Human PML via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Promyelocytic Leukemia (PML)
Species:
Human
Synonyms:
PML, Pml
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Resistance Gene:
Ampicillin
Promoter:
U6 Promoter, Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • PML gRNA vector 1 in pCAS-Guide vector.
  • PML gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Publications
  • Xu, Mallon, Roizman: "PML plays both inimical and beneficial roles in HSV-1 replication." in: Proceedings of the National Academy of Sciences of the United States of America, Vol. 113, Issue 21, pp. E3022-8, 2016 (Pubmed)
Catalog No. ABIN3231147
$1,200.00
1 kit
Plus shipping costs $45.00 Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human TMX1 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Thioredoxin-Related Transmembrane Protein 1 (TMX1)
Species:
Human
Synonyms:
TMX1, Tmx1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Resistance Gene:
Ampicillin
Promoter:
U6 Promoter, Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • TMX1 gRNA vector 1 in pCAS-Guide vector.
  • TMX1 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Publications
  • Raturi, Gutiérrez, Ortiz-Sandoval, Ruangkittisakul, Herrera-Cruz, Rockley, Gesson, Ourdev, Lou, Lucchinetti, Tahbaz, Zaugg, Baksh, Ballanyi, Simmen: "TMX1 determines cancer cell metabolism as a thiol-based modulator of ER-mitochondria Ca2+ flux." in: The Journal of cell biology, Vol. 214, Issue 4, pp. 433-44, 2016 (Pubmed)
Catalog No. ABIN3258143
$1,200.00
1 kit
Plus shipping costs $45.00 Will be delivered in 10 to 12 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - with 3 vectors containing two gRNAs in each vector plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
SAR1 Homolog B (S. Cerevisiae) (SAR1B)
Gene ID:
51128 (Human, SAR1B)
Synonyms:
SAR1B, Sar1B, sar1b, LOC100758826, Sar1b
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5057062
$2,595.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - with 3 vectors containing two gRNAs in each vector plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
PHD Finger Protein 11 (PHF11)
Gene ID:
51131 (Human, PHF11)
Synonyms:
PHF11, Phf11, Phf11a, Phf11c
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5057065
$2,595.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - with 3 vectors containing two gRNAs in each vector plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Interleukin-1 Receptor-Associated Kinase 4 (IRAK4)
Gene ID:
51135 (Human, IRAK4)
Synonyms:
IRAK4, irak4, LOC100227974, Irak4
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5057069
$2,595.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - with 3 vectors containing two gRNAs in each vector plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
COP9 Constitutive Photomorphogenic Homolog Subunit 4 (Arabidopsis) (COPS4)
Gene ID:
51138 (Human, COPS4)
Synonyms:
CSN4, COPS4, CpipJ_CPIJ000966, csn4, Cops4, cops4, COP8, csn-4
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5057071
$2,595.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - with 3 vectors containing two gRNAs in each vector plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Hydroxysteroid (17-Beta) Dehydrogenase 12 (HSD17B12)
Gene ID:
51144 (Human, HSD17B12)
Synonyms:
HSD17B12, LOC100346603, Hsd17b12
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5057075
$2,595.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - with 3 vectors containing two gRNAs in each vector plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Inhibitor of Growth Family, Member 4 (ING4)
Gene ID:
51147 (Human, ING4)
Synonyms:
ing4, ING4, LOC100340491, Ing4
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5057077
$2,595.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - with 3 vectors containing two gRNAs in each vector plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Stromal Cell Derived Factor 4 (SDF4)
Gene ID:
51150 (Human, SDF4)
Synonyms:
SDF4, sdf4, Sdf4
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5057080
$2,595.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - with 3 vectors containing two gRNAs in each vector plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Solute Carrier Family 45, Member 2 (SLC45A2)
Gene ID:
51151 (Human, SLC45A2)
Synonyms:
SLC45A2, slc45a2, LOC100228141, Slc45a2
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5057081
$2,595.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - with 3 vectors containing two gRNAs in each vector plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
serpin Peptidase Inhibitor, Clade A (Alpha-1 Antiproteinase, Antitrypsin), Member 10 (SERPINA10)
Gene ID:
51156 (Human, SERPINA10)
Synonyms:
SERPINA10, Serpina10
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5057084
$2,595.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - with 3 vectors containing two gRNAs in each vector plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Zinc Finger Protein 580 (ZNF580)
Gene ID:
51157 (Human, ZNF580)
Synonyms:
ZNF580, Zfp580
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5057085
$2,595.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - with 3 vectors containing two gRNAs in each vector plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Vacuolar Protein Sorting 28 Homolog (S. Cerevisiae) (VPS28)
Gene ID:
51160 (Human, VPS28)
Synonyms:
Vps28, VPS28, vps28, LOC100389965, LOC100472618, CpipJ_CPIJ003920, LACBIDRAFT_399656, PTRG_04781, MCYG_00028, PITG_04534, Tsp_08691, Tsp_08687, Tsp_08688, vps-28
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5057087
$2,595.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - with 3 vectors containing two gRNAs in each vector plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
EGF-Like-Domain, Multiple 7 (EGFL7)
Gene ID:
51162 (Human, EGFL7)
Synonyms:
egfl7, EGFL7, LOC100226311, Egfl7
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5057089
$2,595.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - with 3 vectors containing two gRNAs in each vector plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Debranching Enzyme Homolog 1 (S. Cerevisiae) (DBR1)
Gene ID:
51163 (Human, DBR1)
Synonyms:
Dbr1, DBR1, dbr1, dbr-1
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5057090
$2,595.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - with 3 vectors containing two gRNAs in each vector plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Cytochrome B5 Reductase 4 (CYB5R4)
Gene ID:
51167 (Human, CYB5R4)
Synonyms:
CYB5R4, TGas070l21.1, LOAG_02505, Tsp_02207, Cyb5r4, cyb5r4
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5057093
$2,595.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - with 3 vectors containing two gRNAs in each vector plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Pleckstrin Homology Domain Containing, Family O Member 1 (PLEKHO1)
Gene ID:
51177 (Human, PLEKHO1)
Synonyms:
PLEKHO1, Plekho1
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5057101
$2,595.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - with 3 vectors containing two gRNAs in each vector plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Dicarbonyl/L-Xylulose Reductase (DCXR)
Gene ID:
51181 (Human, DCXR)
Synonyms:
dcxr, Dcxr, DCXR, CNL05930, NCU09041, AOR_1_494194, AOR_1_156184, AOR_1_970084, VDBG_02657, AOR_1_746114, CGB_D1070C, LOC100223059, GLB1, Glb1
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5057104
$2,595.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - with 3 vectors containing two gRNAs in each vector plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Heat Shock 70kDa Protein 14 (HSPA14)
Gene ID:
51182 (Human, HSPA14)
Synonyms:
HSPA14, hspa14, Hspa14
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5057105
$2,595.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - with 3 vectors containing two gRNAs in each vector plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Synovial Sarcoma Translocation Gene On Chromosome 18-Like 2 (SS18L2)
Gene ID:
51188 (Human, SS18L2)
Synonyms:
Deb1, SS18L2
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5057110
$2,595.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
  • <
  • 1
  • ...
  • ...
  • ...
  • ...
  • ...