You are viewing an incomplete version of our website. Please click to reload the website as full version.

CRISPR/Cas9

CRISPR stands for "Clustered regularly interspaced short palindromic repeats". They were discovered in prokaryotic DNA first in 1987 and contain short repetitions of base sequences. In the course of better sequencing techniques in the early 2000s similar sequences were found in other bacteria as well. Further research revealed that the sequences of repeats in Bacteria chromosomes is interspaced with sequences derived from viruses. So called Cas proteins (CRISPR-associated genes) encodes putative nuclease or helicase proteins. Today we know that the CRISPR-System helps bacteria to acquire a type of immune system. For a short introduction to CRISPR please visit our CRISPR resource page here.

genomics-online offers you currently nearly 40,000 Cas9 enzyme products and ready-to-use plasmids for CRISPR/Cas9. Your advantages: Lower price than customized and faster results. Below you will find all of our CRISPR/Cas9 products.

Click here to visit our CRISPR-plasmid category, or here to see all of our Cas9 enzyme products. If you need help with finding the right product for your needs, our customer support will gladly help you via phone, live chat or email.

307,536 Products
Data Quality
  • 4
Type
  • 307519
  • 16
  • 1
Gene
  • 40
  • 39
  • 36
  • 36
  • 34
Species
  • 140428
  • 101913
  • 65028
  • 110
  • 20
Insert
  • 154627
  • 114974
  • 37890
  • 20
  • 8
Vector
  • 268375
  • 39144
Vector Backbone
  • 115475
  • 114974
  • 39144
  • 37890
  • 3
Fusion tag
  • 230484
  • 39144
  • 37899
  • 9
Bacterial Resistance
  • 307519
Selectable Marker
  • 153375
  • 114974
  • 7
Promoter
  • 269593
  • 153321
  • 39144
Expression Type
  • 307519
  • 268359
Application
  • 922525
  • 477868
  • 421191
  • 307536
    Genome Editing with Engineered Nucleases (GEEN)
  • 9192
Supplier: Log in to see

Knockout Kit for Human PML via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Promyelocytic Leukemia
Species:
Human
Synonyms:
PML, Pml
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Empty Vector:
ABIN4948178
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • PML gRNA vector 1 in pCAS-Guide vector.
  • PML gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Publications
  • Xu, Mallon, Roizman: "PML plays both inimical and beneficial roles in HSV-1 replication." in: Proceedings of the National Academy of Sciences of the United States of America, Vol. 113, Issue 21, pp. E3022-8, 2016 (Pubmed)
Catalog No. ABIN3231147
$1,200.00
1 kit
Plus shipping costs $45.00 Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human TMX1 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Thioredoxin-Related Transmembrane Protein 1
Species:
Human
Synonyms:
TMX1, Tmx1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Empty Vector:
ABIN4948178
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • TMX1 gRNA vector 1 in pCAS-Guide vector.
  • TMX1 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Publications
  • Raturi, Gutiérrez, Ortiz-Sandoval, Ruangkittisakul, Herrera-Cruz, Rockley, Gesson, Ourdev, Lou, Lucchinetti, Tahbaz, Zaugg, Baksh, Ballanyi, Simmen: "TMX1 determines cancer cell metabolism as a thiol-based modulator of ER-mitochondria Ca2+ flux." in: The Journal of cell biology, Vol. 214, Issue 4, pp. 433-44, 2016 (Pubmed)
Catalog No. ABIN3258143
$1,200.00
1 kit
Plus shipping costs $45.00 Will be delivered in 10 to 12 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Protein ZNF783
Gene ID:
100289678 (Human, ZNF783)
Synonyms:
ZNF783
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5047068
$1,535.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Target of Myb 1
Gene ID:
10043 (Human, TOM1)
Synonyms:
TOM1, Tom1
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5047086
$1,535.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Cystatin 8
Gene ID:
10047 (Human, CST8)
Synonyms:
CST8, Cst8
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5047096
$1,535.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
DnaJ (Hsp40) Homolog, Subfamily B, Member 6
Gene ID:
10049 (Human, DNAJB6)
Synonyms:
dnajb6-b, DNAJB6, Dnajb6
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5047098
$1,535.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Solute Carrier Family 17 (Anion/Sugar Transporter), Member 4
Gene ID:
10050 (Human, SLC17A4)
Synonyms:
SLC17A4, Slc17a4
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5047101
$1,535.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Monocyte To Macrophage Differentiation-Associated 2
Gene ID:
100505381 (Human, MMD2)
Synonyms:
MMD2, Mmd2, mmd2a
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5047103
$1,535.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Adaptor-Related Protein Complex 1, mu 2 Subunit
Gene ID:
10053 (Human, AP1m2)
Synonyms:
ap1m2, AP1M2, Ap1m2
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5047184
$1,535.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Histone Deacetylase 5
Gene ID:
10014 (Human, HDAC5)
Synonyms:
HDAC5, Hdac5, HDA05, Hdac6
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5047002
$1,535.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
BCL2-Like 10 (Apoptosis Facilitator)
Gene ID:
10017 (Human, BCL2L10)
Synonyms:
Bcl2l10, BCL2L10
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5047010
$1,535.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Frequently Rearranged in Advanced T-Cell Lymphomas
Gene ID:
10023 (Human, FRAT1)
Synonyms:
FRAT1, frat1, Frat1
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5047024
$1,535.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Trophinin Associated Protein
Gene ID:
10024 (Human, TROAP)
Synonyms:
TROAP, Troap
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5047025
$1,535.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
GPI8
Gene ID:
10026 (Human)
Synonyms:
pigk, PIGK, Pigk
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5047027
$1,535.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Myocyte Enhancer Factor 2B
Gene ID:
100271849 (Human, MEF2B)
Synonyms:
mef2b, MEF2B, Mef2b
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5047030
$1,535.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Tetratricopeptide Repeat Domain 30B
Gene ID:
150737 (Human, TTC30B)
Synonyms:
TTC30B, Ttc30b
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5049997
$1,535.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Transcription Factor 23
Gene ID:
150921 (Human, TCF23)
Synonyms:
TCF23, Tcf23, tcf23
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5050004
$1,535.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Phospholipase B
Gene ID:
151056 (Human, PLB)
Synonyms:
PLN, PLB1, Plb, Plbd1, Plb1
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5050010
$1,535.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Zinc Finger, SWIM-Type Containing 2
Gene ID:
151112 (Human, ZSWIM2)
Synonyms:
ZSWIM2, Zswim2, zgc:165651
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5050012
$1,535.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Zinc Finger Protein 385B
Gene ID:
151126 (Human, ZNF385B)
Synonyms:
ZNF358, znf385b, ZNF385B, Zfp385b
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5050013
$1,535.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Cyclin Y-Like 1
Gene ID:
151195 (Human, CCNYL1)
Synonyms:
ccnyl1-a, ccnyl1, LOC100356703, CCNYL1, Ccnyl1
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5050017
$1,535.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Protein Phosphatase 1, Regulatory (Inhibitor) Subunit 1C
Gene ID:
151242 (Human, PPP1R1C)
Synonyms:
PPP1R1C, Ppp1r1c
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5050020
$1,535.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Growth Differentiation Factor 7
Gene ID:
151449 (Human, GDF7)
Synonyms:
gdf7, GDF7, Gdf7, LOC100339215, LOC100624534
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5050032
$1,535.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Aspartic Peptidase, Retroviral-Like 1
Gene ID:
151516 (Human, ASPRV1)
Synonyms:
ASPRV1, Asprv1, TXN
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5050035
$1,535.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Uridine Phosphorylase 2
Gene ID:
151531 (Human, UPP2)
Synonyms:
upp2, UPP2, udp_2, Tsp_00696, Upp2, LOC100357575, LOC100522709
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5050037
$1,535.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Tetratricopeptide Repeat Domain 14
Gene ID:
151613 (Human, TTC14)
Synonyms:
LOC100230724, TTC14, Ttc14
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5050039
$1,535.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
EF-Hand Domain Family, Member B
Gene ID:
151651 (Human, EFHB)
Synonyms:
EFHB, efhb, Efhb
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5050044
$1,535.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Protein Phosphatase 4, Regulatory Subunit 2
Gene ID:
151987 (Human, PPP4R2)
Synonyms:
ppp4r2a, ppp4r2, PPP4R2, Ppp4r2
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5050055
$1,535.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Ropporin, Rhophilin Associated Protein 1B
Gene ID:
152015 (Human, ROPN1B)
Synonyms:
ROPN1B
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5050061
$1,535.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Zinc Finger Protein 555
Gene ID:
148254 (Human, ZNF555)
Synonyms:
ZNF555
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5049877
$1,535.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
  • <
  • 1
  • ...
  • ...
  • ...
  • ...
  • ...