You are viewing an incomplete version of our website. Please click to reload the website as full version.

CRISPR/Cas9

CRISPR stands for "Clustered regularly interspaced short palindromic repeats". They were discovered in prokaryotic DNA first in 1987 and contain short repetitions of base sequences. In the course of better sequencing techniques in the early 2000s similar sequences were found in other bacteria as well. Further research revealed that the sequences of repeats in Bacteria chromosomes is interspaced with sequences derived from viruses. So called Cas proteins (CRISPR-associated genes) encodes putative nuclease or helicase proteins. Today we know that the CRISPR-System helps bacteria to acquire a type of immune system. For a short introduction to CRISPR please visit our CRISPR resource page here.

genomics-online offers you currently more than 300,000 Cas9 enzyme products and ready-to-use plasmids for CRISPR/Cas9. Your advantages: Lower price than customized and faster results. Below you will find all of our CRISPR/Cas9 products.

Click here to visit our CRISPR-plasmid category, or here to see all of our Cas9 enzyme products. If you need help with finding the right product for your needs, our customer support will gladly help you via phone, live chat or email.

307,532 Products
Data Quality
  • 4
Type
  • 307515
  • 16
  • 1
Gene
  • 40
  • 39
  • 36
  • 36
  • 34
Species
  • 140424
  • 101913
  • 65028
  • 110
  • 20
Insert
  • 154625
  • 114972
  • 37890
  • 20
  • 8
Vector
  • 268371
  • 39144
Vector Backbone
  • 115473
  • 114972
  • 39144
  • 37890
  • 3
Fusion tag
  • 230480
  • 39144
  • 37899
  • 9
Resistance Gene
  • 307515
Selectable Marker
  • 153373
  • 114972
  • 7
Promoter
  • 269589
  • 153319
  • 39144
Expression Type
  • 307515
  • 268355
Application
  • 1094811
  • 477866
  • 421190
  • 307532
    Genome Editing with Engineered Nucleases (GEEN)
  • 9203
Supplier: Log in to see

Knockout Kit for Human PML via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Promyelocytic Leukemia
Species:
Human
Synonyms:
PML, Pml
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Resistance Gene:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • PML gRNA vector 1 in pCAS-Guide vector.
  • PML gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Publications
  • Xu, Mallon, Roizman: "PML plays both inimical and beneficial roles in HSV-1 replication." in: Proceedings of the National Academy of Sciences of the United States of America, Vol. 113, Issue 21, pp. E3022-8, 2016 (Pubmed)
Catalog No. ABIN3231147
$1,200.00
1 kit
Plus shipping costs $45.00 Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human TMX1 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Thioredoxin-Related Transmembrane Protein 1
Species:
Human
Synonyms:
TMX1, Tmx1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Resistance Gene:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • TMX1 gRNA vector 1 in pCAS-Guide vector.
  • TMX1 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Publications
  • Raturi, Gutiérrez, Ortiz-Sandoval, Ruangkittisakul, Herrera-Cruz, Rockley, Gesson, Ourdev, Lou, Lucchinetti, Tahbaz, Zaugg, Baksh, Ballanyi, Simmen: "TMX1 determines cancer cell metabolism as a thiol-based modulator of ER-mitochondria Ca2+ flux." in: The Journal of cell biology, Vol. 214, Issue 4, pp. 433-44, 2016 (Pubmed)
Catalog No. ABIN3258143
$1,200.00
1 kit
Plus shipping costs $45.00 Will be delivered in 10 to 12 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
BR Serine/threonine Kinase 1
Gene ID:
84446 (Human, BRSK1)
Synonyms:
BRSK1, LOC100352646, Brsk1
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5063720
$1,495.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Zinc Finger Protein 333
Gene ID:
84449 (Human, ZNF333)
Synonyms:
ZNF333
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5063723
$1,495.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Dual-Specificity tyrosine-(Y)-phosphorylation Regulated Kinase 2
Gene ID:
8445 (Human, DYRK2)
Synonyms:
DYRK2, CpipJ_CPIJ014802, dyrk2, Dyrk2
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5063724
$1,495.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Junctophilin 4
Gene ID:
84502 (Human, JPH4)
Synonyms:
JPH4, Jph4
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5063744
$1,495.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Zinc Finger Protein 527
Gene ID:
84503 (Human, ZNF527)
Synonyms:
ZNF527
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5063745
$1,495.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Minichromosome Maintenance Deficient 8
Gene ID:
84515 (Human, MCM8)
Synonyms:
MCM8, Mcm8, mcm8
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5063750
$1,495.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Acrosin Binding Protein
Gene ID:
84519 (Human, ACRBP)
Synonyms:
ACRBP, Acrbp
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5063754
$1,495.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Rhox Homeobox Family, Member 2
Gene ID:
84528 (Human, RHOXF2)
Synonyms:
RHOXF2
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5063761
$1,495.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Mitochondrial Ribosomal Protein L43
Gene ID:
84545 (Human, MRPL43)
Synonyms:
MRPL43, Mrpl43
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5063770
$1,495.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
MAK16 Homolog (S. Cerevisiae)
Gene ID:
84549 (Human, MAK16)
Synonyms:
Mak16, mak16, RBM13, MAK16
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5063773
$1,495.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Forkhead Box N1
Gene ID:
8456 (Human, FOXN1)
Synonyms:
FOXN1, foxn1, foxN1, Foxn1
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5063778
$1,495.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
N-Acetylglucosamine-1-Phosphate Transferase, gamma Subunit
Gene ID:
84572 (Human, GNPTG)
Synonyms:
GNPTG, Gnptg
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5063783
$1,495.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Transcription Termination Factor, RNA Polymerase II
Gene ID:
8458 (Human, TTF2)
Synonyms:
ttf2, TTF2, LOC100340161, Ttf2
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5063784
$1,495.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
5'-Nucleotidase, Cytosolic IA
Gene ID:
84618 (Human, NT5C1A)
Synonyms:
nt5c1a, NT5C1A, LOC100340672, Nt5c1a
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5063792
$1,495.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
ST6 beta-Galactosamide alpha-2,6-Sialyltranferase 2
Gene ID:
84620 (Human, ST6GAL2)
Synonyms:
St6gal2, ST6GAL2
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5063795
$1,495.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
SplA/ryanodine Receptor Domain and SOCS Box Containing 2
Gene ID:
84727 (Human, SPSB2)
Synonyms:
SPSB2, Spsb2
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5063870
$1,495.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Ubiquitin Specific Peptidase 30
Gene ID:
84749 (Human, Usp30)
Synonyms:
USP30, usp30, Usp30
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5063876
$1,495.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Zinc Finger Protein 496
Gene ID:
84838 (Human, ZNF496)
Synonyms:
Zfp496, ZNF496, Zkscan17
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5063914
$1,495.00
1 set
Plus shipping costs $45.00 and $21.00 dry ice Will be delivered in 21 to 26 Business Days
  • <
  • 1
  • ...
  • ...
  • ...
  • ...
  • ...