You are viewing an incomplete version of our website. Please click to reload the website as full version.

CRISPR/Cas9

CRISPR stands for "Clustered regularly interspaced short palindromic repeats". They were discovered in prokaryotic DNA first in 1987 and contain short repetitions of base sequences. In the course of better sequencing techniques in the early 2000s similar sequences were found in other bacteria as well. Further research revealed that the sequences of repeats in Bacteria chromosomes is interspaced with sequences derived from viruses. So called Cas proteins (CRISPR-associated genes) encodes putative nuclease or helicase proteins. Today we know that the CRISPR-System helps bacteria to acquire a type of immune system. For a short introduction to CRISPR please visit our CRISPR resource page here.

genomics-online offers you currently nearly 40,000 Cas9 enzyme products and ready-to-use plasmids for CRISPR/Cas9. Your advantages: Lower price than customized and faster results. Below you will find all of our CRISPR/Cas9 products.

Click here to visit our CRISPR-plasmid category, or here to see all of our Cas9 enzyme products. If you need help with finding the right product for your needs, our customer support will gladly help you via phone, live chat or email.

39,161 Products
Type
  • 39144
  • 16
  • 1
Gene
  • 39
  • 8
  • 8
  • 8
  • 6
Species
  • 20116
  • 19014
  • 14
Insert
  • 39144
Vector
  • 39144
Vector Backbone
  • 39144
Fusion tag
  • 17
  • 39144
Bacterial Resistance
  • 39144
Promoter
  • 39144
  • 39144
Expression Type
  • 39144
Application
  • 684956
  • 485846
  • 421191
  • 39161
    Genome Editing with Engineered Nucleases (GEEN)
  • 9182
Supplier: Log in to see

Knockout Kit for Human SLU7 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
SLU7 Splicing Factor Homolog (S. Cerevisiae)
Species:
Human
Synonyms:
Slu7, slu7, SLU7
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • SLU7 gRNA vector 1 in pCAS-Guide vector.
  • SLU7 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3223804
$1,260.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human SMAD1 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
SMAD, Mothers Against DPP Homolog 1
Species:
Human
Synonyms:
smad1, SMAD1, Mad, Smad1, smad1-a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • SMAD1 gRNA vector 1 in pCAS-Guide vector.
  • SMAD1 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3223819
$1,260.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human SMAD2 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
SMAD, Mothers Against DPP Homolog 2
Species:
Human
Synonyms:
SMAD2, smad2, Smad2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • SMAD2 gRNA vector 1 in pCAS-Guide vector.
  • SMAD2 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3223821
$1,260.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Mouse (Murine) Smad1 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
SMAD, Mothers Against DPP Homolog 1
Species:
Mouse (Murine)
Synonyms:
smad1, SMAD1, Mad, Smad1, smad1-a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • Smad1 gRNA vector 1 in pCAS-Guide vector.
  • Smad1 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3223820
$1,260.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Mouse (Murine) Rab24 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
RAB24, Member RAS Oncogene Family
Species:
Mouse (Murine)
Synonyms:
RAB24, LOC100356358, rab24, Rab24
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • Rab24 gRNA vector 1 in pCAS-Guide vector.
  • Rab24 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3224308
$1,260.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human SMAD4 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
SMAD Family Member 4
Species:
Human
Synonyms:
SMAD4, smad4, LOC100342294, Smad4, smad4.1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • SMAD4 gRNA vector 1 in pCAS-Guide vector.
  • SMAD4 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3223825
$1,260.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Mouse (Murine) Smad5 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
SMAD, Mothers Against DPP Homolog 5
Species:
Mouse (Murine)
Synonyms:
SMAD5, smad5, smad4.2-b, Smad5
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • Smad5 gRNA vector 1 in pCAS-Guide vector.
  • Smad5 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3223828
$1,260.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Mouse (Murine) Rab25 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
RAB25, Member RAS Oncogene Family
Species:
Mouse (Murine)
Synonyms:
rab25, RAB25, rab25a, LOC100152692, Rab25
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • Rab25 gRNA vector 1 in pCAS-Guide vector.
  • Rab25 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3224310
$1,260.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human RAB26 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
RAB26, Member RAS Oncogene Family
Species:
Human
Synonyms:
Rab26, RAB26, rab26, Rab28
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • RAB26 gRNA vector 1 in pCAS-Guide vector.
  • RAB26 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3224311
$1,260.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human SMAD5 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
SMAD, Mothers Against DPP Homolog 5
Species:
Human
Synonyms:
SMAD5, smad5, smad4.2-b, Smad5
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • SMAD5 gRNA vector 1 in pCAS-Guide vector.
  • SMAD5 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3223827
$1,260.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Mouse (Murine) Smad4 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
SMAD Family Member 4
Species:
Mouse (Murine)
Synonyms:
SMAD4, smad4, LOC100342294, Smad4, smad4.1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • Smad4 gRNA vector 1 in pCAS-Guide vector.
  • Smad4 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3223826
$1,260.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human SMAD7 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
SMAD, Mothers Against DPP Homolog 7
Species:
Human
Synonyms:
SMAD7, Smad7, smad7
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • SMAD7 gRNA vector 1 in pCAS-Guide vector.
  • SMAD7 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3223831
$1,260.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human RAB27A via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
RAB27A, Member RAS Oncogene Family
Species:
Human
Synonyms:
rab27a, RAB27A, rab27a-b, Rab27a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • RAB27A gRNA vector 1 in pCAS-Guide vector.
  • RAB27A gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3224313
$1,260.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human RAB28 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
RAB28, Member RAS Oncogene Family
Species:
Human
Synonyms:
LOC100224739, LOC100344132, RAB28, Rab28
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • RAB28 gRNA vector 1 in pCAS-Guide vector.
  • RAB28 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3224317
$1,260.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Mouse (Murine) Smad7 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
SMAD, Mothers Against DPP Homolog 7
Species:
Mouse (Murine)
Synonyms:
SMAD7, Smad7, smad7
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • Smad7 gRNA vector 1 in pCAS-Guide vector.
  • Smad7 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3223832
$1,260.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human SMAP1 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Stromal Membrane Associated Protein 1
Species:
Human
Synonyms:
Unc45a, Smap1, SMAP1, smap1, PGTG_10041
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • SMAP1 gRNA vector 1 in pCAS-Guide vector.
  • SMAP1 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3223837
$1,260.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human RAB32 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
RAB32, Member RAS Oncogene Family
Species:
Human
Synonyms:
rab32a, rab32, RAB32, LOC100224194, Rab32
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • RAB32 gRNA vector 1 in pCAS-Guide vector.
  • RAB32 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3224327
$1,260.00
1 kit
Will be delivered in 10 to 12 Business Days
Supplier: Log in to see

Knockout Kit for Human RAB31 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
RAB31, Member RAS Oncogene Family
Species:
Human
Synonyms:
RAB31, rab31, Rab31
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • RAB31 gRNA vector 1 in pCAS-Guide vector.
  • RAB31 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3224325
$1,260.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Mouse (Murine) Rab34 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
RAB34, Member RAS Oncogene Family
Species:
Mouse (Murine)
Synonyms:
Rab34, RAB34
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • Rab34 gRNA vector 1 in pCAS-Guide vector.
  • Rab34 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3224334
$1,260.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human SMARCAD1 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
SWI/SNF-Related, Matrix-Associated Actin-Dependent Regulator of Chromatin, Subfamily A, Containing DEAD/H Box 1
Species:
Human
Synonyms:
SMARCAD1, smarcad1, Smarcad1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • SMARCAD1 gRNA vector 1 in pCAS-Guide vector.
  • SMARCAD1 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3223849
$1,260.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human SMARCD1 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
SWI/SNF Related, Matrix Associated, Actin Dependent Regulator of Chromatin, Subfamily D, Member 1
Species:
Human
Synonyms:
SMARCD1, smarcd1, Smarcd1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • SMARCD1 gRNA vector 1 in pCAS-Guide vector.
  • SMARCD1 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3223859
$1,260.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human SMARCD3 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
SWI/SNF Related, Matrix Associated, Actin Dependent Regulator of Chromatin, Subfamily D, Member 3
Species:
Human
Synonyms:
SMARCD3, smarcd3, Smarcd3, smarcd3b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • SMARCD3 gRNA vector 1 in pCAS-Guide vector.
  • SMARCD3 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3223863
$1,260.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human SMARCD2 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
SWI/SNF Related, Matrix Associated, Actin Dependent Regulator of Chromatin, Subfamily D, Member 2
Species:
Human
Synonyms:
SMARCD2, smarcd2, Smarcd2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • SMARCD2 gRNA vector 1 in pCAS-Guide vector.
  • SMARCD2 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3223861
$1,260.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human RAB39B via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
RAB39B, Member RAS Oncogene Family
Species:
Human
Synonyms:
RAB39B, zgc:165464, LOC100221662, LOC100391697, rab39b, Rab39b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • RAB39B gRNA vector 1 in pCAS-Guide vector.
  • RAB39B gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3224345
$1,260.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human RAB3D via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
RAB3D, Member RAS Oncogene Family
Species:
Human
Synonyms:
RAB3D, rab3d, rab3da, Rab3d
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • RAB3D gRNA vector 1 in pCAS-Guide vector.
  • RAB3D gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3224353
$1,260.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human RAB3GAP1 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
RAB3 GTPase Activating Protein Subunit 1 (Catalytic)
Species:
Human
Synonyms:
Rab3gap1, RAB3GAP1, RGD1306487
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • RAB3GAP1 gRNA vector 1 in pCAS-Guide vector.
  • RAB3GAP1 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3224355
$1,260.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human RAB3IL1 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
RAB3A Interacting Protein (Rabin3)-Like 1
Species:
Human
Synonyms:
RAB3IL1, Rab3il1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • RAB3IL1 gRNA vector 1 in pCAS-Guide vector.
  • RAB3IL1 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3224359
$1,260.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human SMC3 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Structural Maintenance of Chromosomes 3
Species:
Human
Synonyms:
smc3, SMC3, Smc3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • SMC3 gRNA vector 1 in pCAS-Guide vector.
  • SMC3 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3223873
$1,260.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human RAB40B via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
RAB40B, Member RAS Oncogene Family
Species:
Human
Synonyms:
rab40b, LOC100344277, RAB40B, Rab40b, RAB40AL
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • RAB40B gRNA vector 1 in pCAS-Guide vector.
  • RAB40B gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3224365
$1,260.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human RAB40C via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
RAB40C, Member RAS Oncogene Family
Species:
Human
Synonyms:
Rab40c, RAB40C, rab40c
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • RAB40C gRNA vector 1 in pCAS-Guide vector.
  • RAB40C gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3224367
$1,260.00
1 kit
Will be delivered in 21 Business Days
  • <
  • 1
  • ...
  • ...
  • ...
  • ...