You are viewing an incomplete version of our website. Please click to reload the website as full version.

CRISPR/Cas9

CRISPR stands for "Clustered regularly interspaced short palindromic repeats". They were discovered in prokaryotic DNA first in 1987 and contain short repetitions of base sequences. In the course of better sequencing techniques in the early 2000s similar sequences were found in other bacteria as well. Further research revealed that the sequences of repeats in Bacteria chromosomes is interspaced with sequences derived from viruses. So called Cas proteins (CRISPR-associated genes) encodes putative nuclease or helicase proteins. Today we know that the CRISPR-System helps bacteria to acquire a type of immune system. For a short introduction to CRISPR please visit our CRISPR resource page here.

genomics-online offers you currently nearly 40,000 Cas9 enzyme products and ready-to-use plasmids for CRISPR/Cas9. Your advantages: Lower price than customized and faster results. Below you will find all of our CRISPR/Cas9 products.

Click here to visit our CRISPR-plasmid category, or here to see all of our Cas9 enzyme products. If you need help with finding the right product for your needs, our customer support will gladly help you via phone, live chat or email.

77,007 Products
Data Quality
  • 4
Type
  • 76990
  • 16
  • 1
Gene
  • 39
  • 10
  • 9
  • 8
  • 8
Species
  • 56848
  • 20116
  • 26
Insert
  • 39144
  • 37846
Vector
  • 39144
  • 37846
Vector Backbone
  • 39144
  • 37846
Fusion tag
  • 17
  • 39144
  • 37846
Bacterial Resistance
  • 76990
Selectable Marker
  • 37846
Promoter
  • 39144
  • 39144
  • 37846
Expression Type
  • 76990
  • 37846
Application
  • 692056
  • 462748
  • 421191
  • 77007
    Genome Editing with Engineered Nucleases (GEEN)
  • 9182
Supplier: Log in to see

Knockout Kit for Human PML via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Promyelocytic Leukemia
Species:
Human
Synonyms:
PML, Pml
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • PML gRNA vector 1 in pCAS-Guide vector.
  • PML gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Publications
  • Xu, Mallon, Roizman: "PML plays both inimical and beneficial roles in HSV-1 replication." in: Proceedings of the National Academy of Sciences of the United States of America, Vol. 113, Issue 21, pp. E3022-8, 2016 (Pubmed)
Catalog No. ABIN3231147
$1,200.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human TMX1 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Thioredoxin-Related Transmembrane Protein 1
Species:
Human
Synonyms:
TMX1, Tmx1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • TMX1 gRNA vector 1 in pCAS-Guide vector.
  • TMX1 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Publications
  • Raturi, Gutiérrez, Ortiz-Sandoval, Ruangkittisakul, Herrera-Cruz, Rockley, Gesson, Ourdev, Lou, Lucchinetti, Tahbaz, Zaugg, Baksh, Ballanyi, Simmen: "TMX1 determines cancer cell metabolism as a thiol-based modulator of ER-mitochondria Ca2+ flux." in: The Journal of cell biology, Vol. 214, Issue 4, pp. 433-44, 2016 (Pubmed)
Catalog No. ABIN3258143
$1,200.00
1 kit
Will be delivered in 10 to 12 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
N-Acetyltransferase 2 (Arylamine N-Acetyltransferase)
Gene ID:
10 (Human, NAT2)
Synonyms:
Nat2, NAT2, Slc38a1
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5046880
$1,535.00
1 set
Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Adenosine Deaminase
Gene ID:
100 (Human, ADA)
Synonyms:
ADA, Ada, Adgf-A, ada
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5046881
$1,535.00
1 set
Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Mediator Complex Subunit 6
Gene ID:
10001 (Human, MED6)
Synonyms:
AT3G21350, MED6, Med6, med6
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5046885
$1,535.00
1 set
Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Glucosamine-6-Phosphate Deaminase 1
Gene ID:
10007 (Human, GNPDA1)
Synonyms:
gnpda1, GNPDA1, MSMEG_0501, nagB, PPSC2_c4268, LOC100228169, LOC100355853, CE2518, SAS0527, LINJ_32_3460, VIBNI_0170, Gnpda1, GPI
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5046894
$1,535.00
1 set
Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
TRAF Family Member-Associated NFKB Activator
Gene ID:
10010 (Human, TANK)
Synonyms:
TANK, Tank
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5046898
$1,535.00
1 set
Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
BCL2-Like 10 (Apoptosis Facilitator)
Gene ID:
10017 (Human, BCL2L10)
Synonyms:
Bcl2l10, BCL2L10
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5047010
$1,535.00
1 set
Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Frequently Rearranged in Advanced T-Cell Lymphomas
Gene ID:
10023 (Human, FRAT1)
Synonyms:
FRAT1, frat1, Frat1
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5047024
$1,535.00
1 set
Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Trophinin Associated Protein
Gene ID:
10024 (Human, TROAP)
Synonyms:
TROAP, Troap
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5047025
$1,535.00
1 set
Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Myocyte Enhancer Factor 2B
Gene ID:
100271849 (Human, MEF2B)
Synonyms:
mef2b, MEF2B, Mef2b
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5047030
$1,535.00
1 set
Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Histone Deacetylase 5
Gene ID:
10014 (Human, HDAC5)
Synonyms:
HDAC5, Hdac5, HDA05, Hdac6
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5047002
$1,535.00
1 set
Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Target of Myb 1
Gene ID:
10043 (Human, TOM1)
Synonyms:
TOM1, Tom1
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5047086
$1,535.00
1 set
Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
GPI8
Gene ID:
10026 (Human)
Synonyms:
pigk, PIGK, Pigk
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5047027
$1,535.00
1 set
Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Adaptor-Related Protein Complex 1, mu 2 Subunit
Gene ID:
10053 (Human, AP1m2)
Synonyms:
ap1m2, AP1M2, Ap1m2
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5047184
$1,535.00
1 set
Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Cystatin 8
Gene ID:
10047 (Human, CST8)
Synonyms:
CST8, Cst8
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5047096
$1,535.00
1 set
Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Solute Carrier Family 17 (Anion/Sugar Transporter), Member 4
Gene ID:
10050 (Human, SLC17A4)
Synonyms:
SLC17A4, Slc17a4
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5047101
$1,535.00
1 set
Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Protein ZNF783
Gene ID:
100289678 (Human, ZNF783)
Synonyms:
ZNF783
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5047068
$1,535.00
1 set
Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
DnaJ (Hsp40) Homolog, Subfamily B, Member 6
Gene ID:
10049 (Human, DNAJB6)
Synonyms:
dnajb6-b, DNAJB6, Dnajb6
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5047098
$1,535.00
1 set
Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Monocyte To Macrophage Differentiation-Associated 2
Gene ID:
100505381 (Human, MMD2)
Synonyms:
MMD2, Mmd2, mmd2a
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5047103
$1,535.00
1 set
Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
RAS P21 Protein Activator 4
Gene ID:
10156 (Human, RASA4)
Synonyms:
RASA4, Rasa4
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5047306
$1,535.00
1 set
Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Cadherin 18, Type 2
Gene ID:
1016 (Human, CDH18)
Synonyms:
Cdh18, CDH18
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5047310
$1,535.00
1 set
Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Cyclin-Dependent Kinase 5
Gene ID:
1020 (Human, CDK5)
Synonyms:
CDK5, Cdk5, cdk5, LOC100352775
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5047345
$1,535.00
1 set
Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
NME/NM23 Nucleoside Diphosphate Kinase 6
Gene ID:
10201 (Human, NME6)
Synonyms:
NME6, Nme6, LOC509354
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5047347
$1,535.00
1 set
Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Dehydrogenase/reductase (SDR Family) Member 2
Gene ID:
10202 (Human, DHRS2)
Synonyms:
DHRS4, DHRS2, Dhrs2
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5047348
$1,535.00
1 set
Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Cyclin-Dependent Kinase 6
Gene ID:
1021 (Human, CDK6)
Synonyms:
CDK6, Cdk6
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5047356
$1,535.00
1 set
Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Solute Carrier Family 25, Member 13 (Citrin)
Gene ID:
10165 (Human, slc25a13)
Synonyms:
SLC25A13, slc25a13, slc25a12, Slc25a13
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5047316
$1,535.00
1 set
Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
TNF Receptor-Associated Protein 1
Gene ID:
10131 (Human, TRAP1)
Synonyms:
TRAP1, Trap1, TGFBRAP1
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5047283
$1,535.00
1 set
Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Cyclin-Dependent Kinase 2
Gene ID:
1017 (Human, CDK2)
Synonyms:
MGC84068, CINP, cinp, Cdk2, CDK2, cdk2, LOC100154715
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5047320
$1,535.00
1 set
Will be delivered in 21 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - contains 2 gRNA constructs plus a negative control (Viral particles, 100 μL each at 1x10^7 TU/mL)

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
RNA Binding Motif Protein 12
Gene ID:
10137 (Human, RBM12)
Synonyms:
rbm12, LOC733876, RBM12, Rbm12
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient,Stable
Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Viral Particles
Buffer:
100 μL of 1x10^7 TU/mL
Storage:
-80 °C
Catalog No. ABIN5047288
$1,535.00
1 set
Will be delivered in 21 to 26 Business Days
  • <
  • 1
  • ...
  • ...
  • ...
  • ...