You are viewing an incomplete version of our website. Please click to reload the website as full version.

CRISPR/ Cas9 Vectors

Here you can find our complete kits for gene knockout via CRISPR. All products are designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.

Components of all CRISPR/ Cas9 kits: 2 guide-RNA vectors to ensure an efficient cleavage. Donor vector containing left and right homologous arms and GFP-Puro functional cassette. Scramble sequence in pCas-Guide vector as negative control.

Browse our high-quality products. For more detailed information regarding a product please download the datasheet. If you need help with finding the right kit, our customer support will gladly help you via live chat, email or phone.

39,144 Products
Data Quality
  • 4
Type
  • 39144
    Plasmid
Gene
  • 39
  • 9
  • 8
  • 8
  • 6
Species
  • 20116
  • 19014
  • 14
Insert
  • 785870
  • 365420
  • 249906
  • 39144
    gRNA + Cas9
  • 2
Vector
  • 39144
Vector Backbone
  • 39144
Fusion tag
  • 39144
Bacterial Resistance
  • 39144
Promoter
  • 39144
  • 39144
Expression Type
  • 39144
Application
  • 39144
Supplier: Log in to see

Knockout Kit for Mouse (Murine) Stra8 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Stimulated By Retinoic Acid 8
Species:
Mouse (Murine)
Synonyms:
STRA8, Stra8
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • Stra8 gRNA vector 1 in pCAS-Guide vector.
  • Stra8 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3256067
$1,220.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Mouse (Murine) Stra6 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Stimulated By Retinoic Acid 6
Species:
Mouse (Murine)
Synonyms:
Stra6, STRA6
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • Stra6 gRNA vector 1 in pCAS-Guide vector.
  • Stra6 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3256065
$1,220.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human STUB1 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
STIP1 Homology and U-Box Containing Protein 1
Species:
Human
Synonyms:
STUB1, stub1, LOC100282870, CHIP, SETD1B, Stub1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • STUB1 gRNA vector 1 in pCAS-Guide vector.
  • STUB1 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3256093
$1,220.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human STX11 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Syntaxin 11
Species:
Human
Synonyms:
STX11, stx11, Stx11
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • STX11 gRNA vector 1 in pCAS-Guide vector.
  • STX11 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3256096
$1,220.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human SPESP1 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Sperm Equatorial Segment Protein 1
Species:
Human
Synonyms:
LOC100343008, SPESP1, Spesp1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • SPESP1 gRNA vector 1 in pCAS-Guide vector.
  • SPESP1 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3255444
$1,220.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human STX19 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Syntaxin 19
Species:
Human
Synonyms:
STX19, stx19, Stx19
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • STX19 gRNA vector 1 in pCAS-Guide vector.
  • STX19 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3256105
$1,220.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human SPG11 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Spastic Paraplegia 11 (Autosomal Recessive)
Species:
Human
Synonyms:
Spg11, SPG11
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • SPG11 gRNA vector 1 in pCAS-Guide vector.
  • SPG11 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3255446
$1,220.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human SPG7 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Spastic Paraplegia 7
Species:
Human
Synonyms:
SPG7, Spg7
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • SPG7 gRNA vector 1 in pCAS-Guide vector.
  • SPG7 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3255452
$1,220.00
1 kit
Will be delivered in 10 to 12 Business Days
Supplier: Log in to see

Knockout Kit for Mouse (Murine) Stxbp5l via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Syntaxin Binding Protein 5-Like
Species:
Mouse (Murine)
Synonyms:
Stxbp5l, STXBP5L, stxbp5l
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • Stxbp5l gRNA vector 1 in pCAS-Guide vector.
  • Stxbp5l gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3256136
$1,220.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human STYXL1 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
serine/threonine/tyrosine Interacting-Like 1
Species:
Human
Synonyms:
STYXL1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • STYXL1 gRNA vector 1 in pCAS-Guide vector.
  • STYXL1 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3256143
$1,220.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human STYX via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Serine/threonine/tyrosine Interacting Protein
Species:
Human
Synonyms:
STYX, Styx
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • STYX gRNA vector 1 in pCAS-Guide vector.
  • STYX gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3256141
$1,220.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human SPARCL1 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
SPARC-Like 1 (Hevin)
Species:
Human
Synonyms:
LOC445896, SPARCL1, sparcl1, Sparcl1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • SPARCL1 gRNA vector 1 in pCAS-Guide vector.
  • SPARCL1 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3255320
$1,220.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human SULT1A1 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Sulfotransferase Family, Cytosolic, 1A, Phenol-Preferring, Member 1
Species:
Human
Synonyms:
sult1a1, SULT1A1, Sult1a1, Sult1c1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • SULT1A1 gRNA vector 1 in pCAS-Guide vector.
  • SULT1A1 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3256172
$1,220.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human SULT1B1 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Sulfotransferase Family, Cytosolic, 1B, Member 1
Species:
Human
Synonyms:
SULT1B1, sult1b1, Sult1b1, SULT1D1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • SULT1B1 gRNA vector 1 in pCAS-Guide vector.
  • SULT1B1 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3256177
$1,220.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human SULT1C2 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Sulfotransferase Family, Cytosolic, 1C, Member 2
Species:
Human
Synonyms:
sult1c1, sult1c2, SULT1C4, Sult1c1, SULT1C2, Sult1c2, Sult1c3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • SULT1C2 gRNA vector 1 in pCAS-Guide vector.
  • SULT1C2 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3256180
$1,220.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human SULT1C4 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Sulfotransferase Family, Cytosolic, 1C, Member 4
Species:
Human
Synonyms:
SULT1C4
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • SULT1C4 gRNA vector 1 in pCAS-Guide vector.
  • SULT1C4 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3256183
$1,220.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human SULT6B1 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Sulfotransferase Family, Cytosolic, 6B, Member 1
Species:
Human
Synonyms:
SULT6B1, Sult6b1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • SULT6B1 gRNA vector 1 in pCAS-Guide vector.
  • SULT6B1 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3256201
$1,220.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human SULT4A1 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Sulfotransferase Family 4A, Member 1
Species:
Human
Synonyms:
SULT4A1, sult4a1, Sult4a1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • SULT4A1 gRNA vector 1 in pCAS-Guide vector.
  • SULT4A1 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3256198
$1,220.00
1 kit
Will be delivered in 10 to 12 Business Days
Supplier: Log in to see

Knockout Kit for Human SULT2B1 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Sulfotransferase Family, Cytosolic, 2B, Member 1
Species:
Human
Synonyms:
SULT2B1, sult2b1, SULT2B1B, Sult2a2, Sult2b1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • SULT2B1 gRNA vector 1 in pCAS-Guide vector.
  • SULT2B1 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3256195
$1,220.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human SPDYA via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Speedy Homolog A (Xenopus Laevis)
Species:
Human
Synonyms:
SPDYA, spdya, Spdya
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • SPDYA gRNA vector 1 in pCAS-Guide vector.
  • SPDYA gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3255411
$1,220.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Mouse (Murine) Spic via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Spi-C Transcription Factor (Spi-1/PU.1 Related)
Species:
Mouse (Murine)
Synonyms:
LOC100349167, Serpinb6c, SPIC, Spic
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • Spic gRNA vector 1 in pCAS-Guide vector.
  • Spic gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3255466
$1,220.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human SUN1 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Sad1 and UNC84 Domain Containing 1
Species:
Human
Synonyms:
sun-1, SUN1, Sun1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • SUN1 gRNA vector 1 in pCAS-Guide vector.
  • SUN1 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3256214
$1,220.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human SUN2 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Sad1 and UNC84 Domain Containing 2
Species:
Human
Synonyms:
SUN2, Sun2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • SUN2 gRNA vector 1 in pCAS-Guide vector.
  • SUN2 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3256216
$1,220.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human SUOX via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Sulfite Oxidase
Species:
Human
Synonyms:
SUOX, suox, Mb1786, SUOX1, Celly_3002, Suox, SOX
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • SUOX gRNA vector 1 in pCAS-Guide vector.
  • SUOX gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3256222
$1,220.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human SUPT16H via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Suppressor of Ty 16 Homolog (S. Cerevisiae)
Species:
Human
Synonyms:
AOR_1_1808194, CC1G_05155, dre4, SPT16, SPBP8B7.19, spt16, Supt16, supt16h, SUPT16H, Supt16h
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • SUPT16H gRNA vector 1 in pCAS-Guide vector.
  • SUPT16H gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3256225
$1,220.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human SUPT5H via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Transcription Elongation Factor SPT5
Species:
Human
Synonyms:
Spt5, AT2G34210, spt5, MGYG_08422, TERG_05483, PGTG_18458, spt-5, SPT5, Supt5, supt5h, SUPT5H, Supt5h
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • SUPT5H gRNA vector 1 in pCAS-Guide vector.
  • SUPT5H gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3256234
$1,220.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Mouse (Murine) Surf1 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Surfeit 1
Species:
Mouse (Murine)
Synonyms:
Surf1, SURF1, surf1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • Surf1 gRNA vector 1 in pCAS-Guide vector.
  • Surf1 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3256242
$1,220.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human SURF4 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Surfeit 4
Species:
Human
Synonyms:
Surf4, SURF4, surf4, surf4.1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • SURF4 gRNA vector 1 in pCAS-Guide vector.
  • SURF4 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3256245
$1,220.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Mouse (Murine) Surf6 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Surfeit 6
Species:
Mouse (Murine)
Synonyms:
Surf6, RCJMB04_35b4, SURF6, TEgg099p06.1, LOC100222495
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • Surf6 gRNA vector 1 in pCAS-Guide vector.
  • Surf6 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3256248
$1,220.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human SV2A via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Synaptic Vesicle Glycoprotein 2A
Species:
Human
Synonyms:
SV2A, CpipJ_CPIJ017596, sv2a, Sv2a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • SV2A gRNA vector 1 in pCAS-Guide vector.
  • SV2A gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3256269
$1,220.00
1 kit
Will be delivered in 21 Business Days
  • <
  • 1
  • ...
  • ...
  • ...
  • ...