You are viewing an incomplete version of our website. Please click to reload the website as full version.

CRISPR/ Cas9 Vectors

Here you can find our complete kits for gene knockout via CRISPR. All products are designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.

Components of all CRISPR/ Cas9 kits: 2 guide-RNA vectors to ensure an efficient cleavage. Donor vector containing left and right homologous arms and GFP-Puro functional cassette. Scramble sequence in pCas-Guide vector as negative control.

Browse our high-quality products. For more detailed information regarding a product please download the datasheet. If you need help with finding the right kit, our customer support will gladly help you via live chat, email or phone.

39,144 Products
Data Quality
  • 4
Type
  • 39144
    Plasmid
Gene
  • 39
  • 9
  • 8
  • 8
  • 6
Species
  • 20116
  • 19014
  • 14
Insert
  • 785868
  • 365420
  • 249950
  • 39144
    gRNA + Cas9
  • 37846
Vector
  • 39144
Vector Backbone
  • 39144
Fusion tag
  • 39144
Bacterial Resistance
  • 39144
Promoter
  • 39144
  • 39144
Expression Type
  • 39144
Application
  • 39144
Supplier: Log in to see

Knockout Kit for Human PML via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Promyelocytic Leukemia
Species:
Human
Synonyms:
PML, Pml
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • PML gRNA vector 1 in pCAS-Guide vector.
  • PML gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Publications
  • Xu, Mallon, Roizman: "PML plays both inimical and beneficial roles in HSV-1 replication." in: Proceedings of the National Academy of Sciences of the United States of America, Vol. 113, Issue 21, pp. E3022-8, 2016 (Pubmed)
Catalog No. ABIN3231147
$1,200.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human TMX1 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Thioredoxin-Related Transmembrane Protein 1
Species:
Human
Synonyms:
TMX1, Tmx1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • TMX1 gRNA vector 1 in pCAS-Guide vector.
  • TMX1 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Publications
  • Raturi, Gutiérrez, Ortiz-Sandoval, Ruangkittisakul, Herrera-Cruz, Rockley, Gesson, Ourdev, Lou, Lucchinetti, Tahbaz, Zaugg, Baksh, Ballanyi, Simmen: "TMX1 determines cancer cell metabolism as a thiol-based modulator of ER-mitochondria Ca2+ flux." in: The Journal of cell biology, Vol. 214, Issue 4, pp. 433-44, 2016 (Pubmed)
Catalog No. ABIN3258143
$1,200.00
1 kit
Will be delivered in 10 to 12 Business Days
Supplier: Log in to see

Knockout Kit for Human KSR2 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Kinase Suppressor of Ras 2
Species:
Human
Synonyms:
KSR2, Ksr2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • KSR2 gRNA vector 1 in pCAS-Guide vector.
  • KSR2 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3240738
$1,200.00
1 kit
Will be delivered in 10 to 12 Business Days
Supplier: Log in to see

Knockout Kit for Human LACTB via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Lactamase, beta
Species:
Human
Synonyms:
bla2, bla1, ampC, PSPTO_2834, GSU1378, MCA2220, SPO1641, SPO1960, CJE0344, Rmar_1357, MGYG_07395, ML5_3452, bla, blaCTX-M-15, LOC100346457, LACTB, Lactb, LOC787642, lactb
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • LACTB gRNA vector 1 in pCAS-Guide vector.
  • LACTB gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3240773
$1,200.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human LAD1 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Ladinin 1
Species:
Human
Synonyms:
LAD1, lad1, LOC100343996, Lad1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • LAD1 gRNA vector 1 in pCAS-Guide vector.
  • LAD1 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3240777
$1,200.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human LALBA via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Lactalbumin, alpha-
Species:
Human
Synonyms:
LALBA, Lalba
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • LALBA gRNA vector 1 in pCAS-Guide vector.
  • LALBA gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3240786
$1,200.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human LAMC2 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Laminin, gamma 2
Species:
Human
Synonyms:
LAMC2, Lamc2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • LAMC2 gRNA vector 1 in pCAS-Guide vector.
  • LAMC2 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3240806
$1,200.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human LANCL1 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
LanC Lantibiotic Synthetase Component C-Like 1 (Bacterial)
Species:
Human
Synonyms:
LANCL1, lancl1, Lancl1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • LANCL1 gRNA vector 1 in pCAS-Guide vector.
  • LANCL1 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3240828
$1,200.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human LANCL2 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
LanC Lantibiotic Synthetase Component C-Like 2 (Bacterial)
Species:
Human
Synonyms:
Lancl2, LANCL2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • LANCL2 gRNA vector 1 in pCAS-Guide vector.
  • LANCL2 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3240830
$1,200.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human KREMEN1 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Kringle Containing Transmembrane Protein 1
Species:
Human
Synonyms:
KREMEN1, kremen1, Kremen1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • KREMEN1 gRNA vector 1 in pCAS-Guide vector.
  • KREMEN1 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3240537
$1,200.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human KREMEN2 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Kringle Containing Transmembrane Protein 2
Species:
Human
Synonyms:
kremen2, KREMEN2, Kremen2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • KREMEN2 gRNA vector 1 in pCAS-Guide vector.
  • KREMEN2 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3240539
$1,200.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human KRIT1 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
KRIT1, Ankyrin Repeat Containing
Species:
Human
Synonyms:
Krit1, KRIT1, krit1, CALM
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • KRIT1 gRNA vector 1 in pCAS-Guide vector.
  • KRIT1 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3240543
$1,200.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human KRR1 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
KRR1, Small Subunit (SSU) Processome Component, Homolog (Yeast)
Species:
Human
Synonyms:
krr1, KRR1, Krr1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • KRR1 gRNA vector 1 in pCAS-Guide vector.
  • KRR1 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3240545
$1,200.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human KRT75 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Keratin 75
Species:
Human
Synonyms:
KRT75, krt75, Krt75
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • KRT75 gRNA vector 1 in pCAS-Guide vector.
  • KRT75 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3240624
$1,200.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human KRT81 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Keratin 81
Species:
Human
Synonyms:
KRT81, LOC100526784, Krt81
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • KRT81 gRNA vector 1 in pCAS-Guide vector.
  • KRT81 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3240638
$1,200.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human LBX1 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Ladybird Homeobox 1
Species:
Human
Synonyms:
LBX1, Lbx1, lbx1, lbx1b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • LBX1 gRNA vector 1 in pCAS-Guide vector.
  • LBX1 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3240883
$1,200.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Mouse (Murine) Lbx2 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Ladybird Homeobox 2
Species:
Mouse (Murine)
Synonyms:
LBX2, Lbx2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • Lbx2 gRNA vector 1 in pCAS-Guide vector.
  • Lbx2 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3240886
$1,200.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human LCAT via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Lecithin-Cholesterol Acyltransferase
Species:
Human
Synonyms:
LCAT, lcat, Lcat
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • LCAT gRNA vector 1 in pCAS-Guide vector.
  • LCAT gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3240891
$1,200.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human LCN6 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Lipocalin 6
Species:
Human
Synonyms:
LCN6, Lcn6
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • LCN6 gRNA vector 1 in pCAS-Guide vector.
  • LCN6 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3240948
$1,200.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Mouse (Murine) Lcor via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Ligand Dependent Nuclear Receptor Corepressor
Species:
Mouse (Murine)
Synonyms:
LCOR, lcor, Lcor
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • Lcor gRNA vector 1 in pCAS-Guide vector.
  • Lcor gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3240956
$1,200.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human LCORL via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Ligand Dependent Nuclear Receptor Corepressor-Like
Species:
Human
Synonyms:
LCORL, lcorl, LOC100347964, Lcorl
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • LCORL gRNA vector 1 in pCAS-Guide vector.
  • LCORL gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3240957
$1,200.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human LCP2 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Lymphocyte Cytosolic Protein 2 (SH2 Domain Containing Leukocyte Protein of 76kDa)
Species:
Human
Synonyms:
Lcp2, LCP2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • LCP2 gRNA vector 1 in pCAS-Guide vector.
  • LCP2 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3240961
$1,200.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human LCTL via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Lactase-Like
Species:
Human
Synonyms:
LCTL, Lctl
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • LCTL gRNA vector 1 in pCAS-Guide vector.
  • LCTL gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3240965
$1,200.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human LDB1 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
LIM Domain Binding 1
Species:
Human
Synonyms:
ldb1, Ldb1, LDB1, xldb1, ldb1b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • LDB1 gRNA vector 1 in pCAS-Guide vector.
  • LDB1 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3240967
$1,200.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human LDHA via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Lactate Dehydrogenase A
Species:
Human
Synonyms:
ldha, ldha-b, LDHA, Ldha, LOC100357659, ldhb-b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • LDHA gRNA vector 1 in pCAS-Guide vector.
  • LDHA gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3240973
$1,200.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human LDHAL6A via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Lactate Dehydrogenase A-Like 6A
Species:
Human
Synonyms:
LDHAL6A
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • LDHAL6A gRNA vector 1 in pCAS-Guide vector.
  • LDHAL6A gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3240975
$1,200.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human LDHAL6B via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Lactate Dehydrogenase A-Like 6B
Species:
Human
Synonyms:
Ldhal6b, LDHAL6B, LOC100338725
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • LDHAL6B gRNA vector 1 in pCAS-Guide vector.
  • LDHAL6B gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3240976
$1,200.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human LDHD via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Lactate Dehydrogenase D
Species:
Human
Synonyms:
LDHD, ldhd, LOC100341422, Ldhd
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • LDHD gRNA vector 1 in pCAS-Guide vector.
  • LDHD gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3240982
$1,200.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human LEO1 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Leo1, Paf1/RNA Polymerase II Complex Component, Homolog (S. Cerevisiae)
Species:
Human
Synonyms:
LEO1, leo1, Leo1, LOC415420
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • LEO1 gRNA vector 1 in pCAS-Guide vector.
  • LEO1 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3241030
$1,200.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human LAYN via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Layilin
Species:
Human
Synonyms:
LOC100061887, LAYN, layna, LOC100358578, Layn
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • LAYN gRNA vector 1 in pCAS-Guide vector.
  • LAYN gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3240875
$1,200.00
1 kit
Will be delivered in 21 Business Days
  • <
  • 1
  • ...
  • ...
  • ...
  • ...