You are viewing an incomplete version of our website. Please click to reload the website as full version.

CRISPR/ Cas9 Vectors

Here you can find our complete kits for gene knockout via CRISPR. All products are designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.

Components of all CRISPR/ Cas9 kits: 2 guide-RNA vectors to ensure an efficient cleavage. Donor vector containing left and right homologous arms and GFP-Puro functional cassette. Scramble sequence in pCas-Guide vector as negative control.

Browse our high-quality products. For more detailed information regarding a product please download the datasheet. If you need help with finding the right kit, our customer support will gladly help you via live chat, email or phone.

154,627 Products
Data Quality
  • 4
Type
  • 154627
    Plasmid
Gene
  • 39
  • 22
  • 18
  • 18
  • 18
Species
  • 61109
  • 60924
  • 32526
  • 58
  • 8
Insert
  • 785888
  • 365420
  • 265062
  • 154627
    gRNA + Cas9
  • 114974
Vector
  • 115483
  • 39144
Vector Backbone
  • 115475
  • 39144
  • 1
  • 1
  • 1
Fusion tag
  • 115479
  • 39144
  • 2
  • 2
Bacterial Resistance
  • 154627
Selectable Marker
  • 115478
  • 1
Promoter
  • 154619
  • 115475
  • 39144
Expression Type
  • 154627
  • 115480
Application
  • 154627
  • 115475
  • 8
Supplier: Log in to see

Knockout Kit for Human PML via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Promyelocytic Leukemia
Species:
Human
Synonyms:
PML, Pml
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Empty Vector:
ABIN4948178
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • PML gRNA vector 1 in pCAS-Guide vector.
  • PML gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Publications
  • Xu, Mallon, Roizman: "PML plays both inimical and beneficial roles in HSV-1 replication." in: Proceedings of the National Academy of Sciences of the United States of America, Vol. 113, Issue 21, pp. E3022-8, 2016 (Pubmed)
Catalog No. ABIN3231147
$1,200.00
1 kit
Plus shipping costs $45.00 Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human TMX1 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Thioredoxin-Related Transmembrane Protein 1
Species:
Human
Synonyms:
TMX1, Tmx1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Empty Vector:
ABIN4948178
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • TMX1 gRNA vector 1 in pCAS-Guide vector.
  • TMX1 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Publications
  • Raturi, Gutiérrez, Ortiz-Sandoval, Ruangkittisakul, Herrera-Cruz, Rockley, Gesson, Ourdev, Lou, Lucchinetti, Tahbaz, Zaugg, Baksh, Ballanyi, Simmen: "TMX1 determines cancer cell metabolism as a thiol-based modulator of ER-mitochondria Ca2+ flux." in: The Journal of cell biology, Vol. 214, Issue 4, pp. 433-44, 2016 (Pubmed)
Catalog No. ABIN3258143
$1,200.00
1 kit
Plus shipping costs $45.00 Will be delivered in 10 to 12 Business Days
Supplier: Log in to see

Individual gRNA against FKBP4 in Lentiviarl Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
FK506 Binding Protein 4, 59kDa
NCBI Accession:
NM_002014
Species:
Human
Synonyms:
FKBP4, fkbp4, LOC100229761, Fkbp4
Vector type:
Lentiviral Vector
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter,SFFV Promoter
Expression:
Stable,Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of FKBP4
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5203796
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
Supplier: Log in to see

Individual gRNA against FHL1 in Lentiviarl Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Four and A Half LIM Domains 1
NCBI Accession:
NR_027621
Species:
Human
Synonyms:
fhl1, FHL1, LOC100357263, fhl1a, Fhl1, FHL1C
Vector type:
Lentiviral Vector
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter,SFFV Promoter
Expression:
Stable,Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of FHL1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5203720
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
Supplier: Log in to see

Individual gRNA against FHL1 in Lentiviarl Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Four and A Half LIM Domains 1
NCBI Accession:
NR_027621
Species:
Human
Synonyms:
fhl1, FHL1, LOC100357263, fhl1a, Fhl1, FHL1C
Vector type:
Lentiviral Vector
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter,SFFV Promoter
Expression:
Stable,Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of FHL1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5203721
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
Supplier: Log in to see

Individual gRNA against FHL1 in Lentiviarl Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Four and A Half LIM Domains 1
NCBI Accession:
NR_027621
Species:
Human
Synonyms:
fhl1, FHL1, LOC100357263, fhl1a, Fhl1, FHL1C
Vector type:
Lentiviral Vector
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter,SFFV Promoter
Expression:
Stable,Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of FHL1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5203722
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
Supplier: Log in to see

Individual gRNA against FKBP10 in Lentiviarl Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
FK506 Binding Protein 10, 65 KDa
NCBI Accession:
NM_021939
Species:
Human
Synonyms:
fkbp10, FKBP10, fkbp10b, Fkbp10
Vector type:
Lentiviral Vector
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter,SFFV Promoter
Expression:
Stable,Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of FKBP10
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5203762
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
Supplier: Log in to see

Individual gRNA against FKBP1B in Lentiviarl Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
FK506 Binding Protein 1B, 12.6 KDa
NCBI Accession:
NM_004116
Species:
Human
Synonyms:
FKBP1B, fkbp1b, LOC100230320, Fkbp1b
Vector type:
Lentiviral Vector
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter,SFFV Promoter
Expression:
Stable,Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of FKBP1B
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5203778
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
Supplier: Log in to see

Individual gRNA against ZNF768 in Lentiviarl Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Zinc Finger Protein 768
NCBI Accession:
NM_024671
Species:
Human
Synonyms:
ZNF768, Zfp768, LOC507011
Vector type:
Lentiviral Vector
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter,SFFV Promoter
Expression:
Stable,Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ZNF768
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5203834
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
Supplier: Log in to see

Individual gRNA against HOXB9 in Lentiviarl Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Homeobox B9
NCBI Accession:
NM_024017
Species:
Human
Synonyms:
hoxb9a, hoxb9, HOXB9, LOC100345878, Hoxb9
Vector type:
Lentiviral Vector
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter,SFFV Promoter
Expression:
Stable,Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of HOXB9
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5205736
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
Supplier: Log in to see

Individual gRNA against HMBOX1 in Lentiviarl Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Homeobox Containing 1
NCBI Accession:
NM_001135726
Species:
Human
Synonyms:
hmbox1-b, HMBOX1, hmbox1-a, Hmbox1, hmbox1a
Vector type:
Lentiviral Vector
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter,SFFV Promoter
Expression:
Stable,Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of HMBOX1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5205742
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
Supplier: Log in to see

Individual gRNA against HOXA9 in Lentiviarl Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Homeobox A9
NCBI Accession:
NM_152739
Species:
Human
Synonyms:
HOXA9, hxoa9a, hoxa9, Hoxa9
Vector type:
Lentiviral Vector
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter,SFFV Promoter
Expression:
Stable,Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of HOXA9
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5205746
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
Supplier: Log in to see

Individual gRNA against MKRN2 in Lentiviarl Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Makorin Ring Finger Protein 2
NCBI Accession:
NM_014160
Species:
Human
Synonyms:
MKRN2, LOC100340148, mkrn2, Mkrn2
Vector type:
Lentiviral Vector
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter,SFFV Promoter
Expression:
Stable,Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of MKRN2
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5205808
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
Supplier: Log in to see

Individual gRNA against MALT1 in Lentiviarl Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Mucosa Associated Lymphoid Tissue Lymphoma Translocation Gene 1
NCBI Accession:
NM_006785
Species:
Human
Synonyms:
malt1a, MALT1, malt1, Malt1
Vector type:
Lentiviral Vector
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter,SFFV Promoter
Expression:
Stable,Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of MALT1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5205832
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
Supplier: Log in to see

Individual gRNA against SULT2B1 in Lentiviarl Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Sulfotransferase Family, Cytosolic, 2B, Member 1
NCBI Accession:
NM_004605
Species:
Human
Synonyms:
SULT2B1, sult2b1, SULT2B1B, Sult2a2, Sult2b1
Vector type:
Lentiviral Vector
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter,SFFV Promoter
Expression:
Stable,Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of SULT2B1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5205866
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
Supplier: Log in to see

Individual gRNA against HIC1 in Lentiviarl Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Hypermethylated in Cancer 1
NCBI Accession:
NM_001098202
Species:
Human
Synonyms:
hic1, HIC1, Hic1
Vector type:
Lentiviral Vector
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter,SFFV Promoter
Expression:
Stable,Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of HIC1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5205872
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
Supplier: Log in to see

Individual gRNA against HOXD11 in Lentiviarl Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Homeobox D11
NCBI Accession:
NM_021192
Species:
Human
Synonyms:
hoxd11a, HOXD11, hoxd11, LOC100229370, Hoxd11
Vector type:
Lentiviral Vector
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter,SFFV Promoter
Expression:
Stable,Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of HOXD11
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5205712
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
Supplier: Log in to see

Individual gRNA against HOXD12 in Lentiviarl Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Homeobox D12
NCBI Accession:
NM_021193
Species:
Human
Synonyms:
HOXD12, hoxd12a, LOC100351997, Hoxd12
Vector type:
Lentiviral Vector
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter,SFFV Promoter
Expression:
Stable,Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of HOXD12
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5205716
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
Supplier: Log in to see

Individual gRNA against HOXB8 in Lentiviarl Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Homeobox B8
NCBI Accession:
NM_024016
Species:
Human
Synonyms:
Hoxb8, HOXB8, LOC100627661
Vector type:
Lentiviral Vector
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter,SFFV Promoter
Expression:
Stable,Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of HOXB8
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5205726
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
Supplier: Log in to see

Individual gRNA against HIPK1 in Lentiviarl Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Homeodomain Interacting Protein Kinase 1
NCBI Accession:
NM_198268
Species:
Human
Synonyms:
HIPK1, hipk1, Hipk1
Vector type:
Lentiviral Vector
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter,SFFV Promoter
Expression:
Stable,Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of HIPK1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5205782
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
Supplier: Log in to see

Individual gRNA against Lhx2 in Lentiviarl Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
LIM Homeobox 2
NCBI Accession:
NM_010710
Species:
Mouse (Murine)
Synonyms:
lhx2, LHX2, Lhx2, lhx2b
Vector type:
Lentiviral Vector
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter,SFFV Promoter
Expression:
Stable,Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Lhx2
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5205760
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
Supplier: Log in to see

Individual gRNA against Lhx2 in Lentiviarl Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
LIM Homeobox 2
NCBI Accession:
NM_001106571
Species:
Rat (Rattus)
Synonyms:
lhx2, LHX2, Lhx2, lhx2b
Vector type:
Lentiviral Vector
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter,SFFV Promoter
Expression:
Stable,Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Lhx2
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5205762
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
Supplier: Log in to see

Individual gRNA against Myf5 in Lentiviarl Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Myogenic Factor 5
NCBI Accession:
NM_008656
Species:
Mouse (Murine)
Synonyms:
myf5, MYF5, Myf5
Vector type:
Lentiviral Vector
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter,SFFV Promoter
Expression:
Stable,Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Myf5
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5207922
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
Supplier: Log in to see

Individual gRNA against Myf5 in Lentiviarl Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Myogenic Factor 5
NCBI Accession:
NM_001106783
Species:
Rat (Rattus)
Synonyms:
myf5, MYF5, Myf5
Vector type:
Lentiviral Vector
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter,SFFV Promoter
Expression:
Stable,Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Myf5
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5207924
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
Supplier: Log in to see

Individual gRNA against MYLIP in Lentiviarl Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Myosin Regulatory Light Chain Interacting Protein
NCBI Accession:
NM_013262
Species:
Human
Synonyms:
mylipa, MYLIP, mylip, Mylip
Vector type:
Lentiviral Vector
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter,SFFV Promoter
Expression:
Stable,Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of MYLIP
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5207932
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
Supplier: Log in to see

Individual gRNA against MVP in Lentiviarl Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Major Vault Protein
NCBI Accession:
NM_017458
Species:
Human
Synonyms:
mvp, Tc00.1047053510353.10, Tb927.5.4460, Tb10.70.0520, Tb10.70.5840, LmjF05.0060, mvpA, mvpB, MVP, Mvp, Ptpra
Vector type:
Lentiviral Vector
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter,SFFV Promoter
Expression:
Stable,Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of MVP
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5207978
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
Supplier: Log in to see

Individual gRNA against MKRN1 in Lentiviarl Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Makorin Ring Finger Protein 1
NCBI Accession:
NM_013446
Species:
Human
Synonyms:
MKRN1, MGC84269, Mkrn1
Vector type:
Lentiviral Vector
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter,SFFV Promoter
Expression:
Stable,Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of MKRN1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5207984
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
Supplier: Log in to see

Individual gRNA against MYO1A in Lentiviarl Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Myosin IA
NCBI Accession:
NM_005379
Species:
Human
Synonyms:
Myo31DF, myo1a, MYO1A, Myo1a
Vector type:
Lentiviral Vector
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter,SFFV Promoter
Expression:
Stable,Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of MYO1A
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5207942
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
Supplier: Log in to see

Individual gRNA against MYO9B in Lentiviarl Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Myosin IXB
NCBI Accession:
NM_004145
Species:
Human
Synonyms:
MYO9B, myo9b, Myo9b, LOC100364284
Vector type:
Lentiviral Vector
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter,SFFV Promoter
Expression:
Stable,Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of MYO9B
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5207950
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
Supplier: Log in to see

Individual gRNA against MYRIP in Lentiviarl Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Myosin VIIA and Rab Interacting Protein
NCBI Accession:
NM_015460
Species:
Human
Synonyms:
MYRIP, si:ch211-106h4.9, myrip, LOC100156583, Myrip
Vector type:
Lentiviral Vector
Bacterial Resistance:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter,SFFV Promoter
Expression:
Stable,Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of MYRIP
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5207962
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
  • <
  • 1
  • ...
  • ...
  • ...
  • ...
  • ...