CRISPR/ Cas9 Vectors

Here you can find our complete kits for gene knockout via CRISPR. All products are designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.

Components of all CRISPR/ Cas9 kits: 2 guide-RNA vectors to ensure an efficient cleavage. Donor vector containing left and right homologous arms and GFP-Puro functional cassette. Scramble sequence in pCas-Guide vector as negative control.

Browse our high-quality products. For more detailed information regarding a product please download the datasheet. If you need help with finding the right kit, our customer support will gladly help you via live chat, email or phone.

154,617 Products
Data Quality
  • 4
Type
  • 154617
    Plasmid
Gene
  • 39
  • 22
  • 18
  • 18
  • 18
Species
  • 61109
  • 60922
  • 32526
  • 58
  • 2
Insert
  • 585860
  • 397475
  • 215849
  • 154617
    gRNA + Cas9
  • 114972
Vector
  • 115473
  • 39144
Vector Backbone
  • 115473
  • 39144
Fusion tag
  • 115473
  • 39144
Resistance Gene
  • 154617
Selectable Marker
  • 115473
Promoter
  • 154617
  • 115473
  • 39144
Expression Type
  • 154617
  • 115473
Application
  • 154617
  • 115473
Supplier: Log in to see

Knockout Kit for Human PML via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Promyelocytic Leukemia (PML)
Species:
Human
Synonyms:
PML, Pml
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Resistance Gene:
Ampicillin
Promoter:
U6 Promoter, Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • PML gRNA vector 1 in pCAS-Guide vector.
  • PML gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Publications
  • Xu, Mallon, Roizman: "PML plays both inimical and beneficial roles in HSV-1 replication." in: Proceedings of the National Academy of Sciences of the United States of America, Vol. 113, Issue 21, pp. E3022-8, 2016 (Pubmed)
Catalog No. ABIN3231147
$1,200.00
1 kit
Plus shipping costs $45.00 Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human TMX1 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Thioredoxin-Related Transmembrane Protein 1 (TMX1)
Species:
Human
Synonyms:
TMX1, Tmx1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Resistance Gene:
Ampicillin
Promoter:
U6 Promoter, Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • TMX1 gRNA vector 1 in pCAS-Guide vector.
  • TMX1 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Publications
  • Raturi, Gutiérrez, Ortiz-Sandoval, Ruangkittisakul, Herrera-Cruz, Rockley, Gesson, Ourdev, Lou, Lucchinetti, Tahbaz, Zaugg, Baksh, Ballanyi, Simmen: "TMX1 determines cancer cell metabolism as a thiol-based modulator of ER-mitochondria Ca2+ flux." in: The Journal of cell biology, Vol. 214, Issue 4, pp. 433-44, 2016 (Pubmed)
Catalog No. ABIN3258143
$1,200.00
1 kit
Plus shipping costs $45.00 Will be delivered in 10 to 12 Business Days
Supplier: Log in to see

Individual gRNA against FH in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Fumarate Hydratase (FH)
NCBI Accession:
NM_000143
Species:
Human
Synonyms:
FH, fumH, Fh, fh, Fh1
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of FH
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5197286
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
Supplier: Log in to see

Individual gRNA against APOLD1 in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Apolipoprotein L Domain Containing 1 (APOLD1)
NCBI Accession:
NM_030817
Species:
Human
Synonyms:
Apold1, APOLD1, apold1
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of APOLD1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5198114
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
Supplier: Log in to see

Individual gRNA against FUK in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Fucokinase (FUK)
NCBI Accession:
NM_145059
Species:
Human
Synonyms:
FUK, Bache_1982, Sgly_1597, Bacsa_0234, fuk, LOC100348059, Fuk
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of FUK
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5197280
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
Supplier: Log in to see

Individual gRNA against ARHGAP1 in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
rho GTPase Activating Protein 1 (ARHGAP1)
NCBI Accession:
NM_004308
Species:
Human
Synonyms:
Arhgap32, Arhgap1, ARHGAP1
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ARHGAP1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5198138
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
Supplier: Log in to see

Individual gRNA against SRGAP1 in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
SLIT-ROBO rho GTPase Activating Protein 1 (SRGAP1)
NCBI Accession:
NM_020762
Species:
Human
Synonyms:
SRGAP1, srgap1, Srgap1
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of SRGAP1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5198144
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
Supplier: Log in to see

Individual gRNA against ARHGAP4 in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
rho GTPase Activating Protein 4 (ARHGAP4)
NCBI Accession:
NM_001666
Species:
Human
Synonyms:
arhgap4a, ARHGAP4, arhgap4, Arhgap4
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ARHGAP4
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5198162
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
Supplier: Log in to see

Individual gRNA against EIF4ENIF1 in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Eukaryotic Translation Initiation Factor 4E Nuclear Import Factor 1 (EIF4ENIF1)
NCBI Accession:
NM_019843
Species:
Human
Synonyms:
Eif4enif1, EIF4ENIF1, eif4enif1
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of EIF4ENIF1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5197450
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
Supplier: Log in to see

Individual gRNA against ARNT2 in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Aryl Hydrocarbon Receptor Nuclear Translocator 2 (ARNT2)
NCBI Accession:
NM_014862
Species:
Human
Synonyms:
ARNT2, arnt2, arnt.2, Arnt2
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ARNT2
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5198210
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
Supplier: Log in to see

Individual gRNA against ASPA in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Aspartoacylase (ASPA)
NCBI Accession:
NM_000049
Species:
Human
Synonyms:
ASPA, aspa, Fbal_2465, Aspa
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ASPA
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5198250
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
Supplier: Log in to see

Individual gRNA against ATF1 in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Activating Transcription Factor 1 (AFT1)
NCBI Accession:
NM_005171
Species:
Human
Synonyms:
atf1, ATF1, MGC85066, Atf1, LOC100340999
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ATF1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5198266
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
Supplier: Log in to see

Individual gRNA against ATF6 in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Activating Transcription Factor 6 (ATF6)
NCBI Accession:
NM_007348
Species:
Human
Synonyms:
ATF6, Atf6, atf6
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ATF6
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5198284
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
Supplier: Log in to see

Individual gRNA against ATF7 in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Activating Transcription Factor 7 (AFT7)
NCBI Accession:
NM_006856
Species:
Human
Synonyms:
ATF7, atf7b, atf7, Atf7
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ATF7
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5198292
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
Supplier: Log in to see

Individual gRNA against ATM in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Ataxia Telangiectasia Mutated (ATM)
NCBI Accession:
NM_000051
Species:
Human
Synonyms:
tefu, atm, ATM, EDI_100660, CpipJ_CPIJ001772, BDBG_08252, PAAG_02532, MCYG_05088, VDBG_06833, ACLA_015700, AaeL_AAEL014900, MGYG_07634, PGTG_14279, Atm, LOC100349299
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ATM
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5198300
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
Supplier: Log in to see

Individual gRNA against ATM in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Ataxia Telangiectasia Mutated (ATM)
NCBI Accession:
NM_000051
Species:
Human
Synonyms:
tefu, atm, ATM, EDI_100660, CpipJ_CPIJ001772, BDBG_08252, PAAG_02532, MCYG_05088, VDBG_06833, ACLA_015700, AaeL_AAEL014900, MGYG_07634, PGTG_14279, Atm, LOC100349299
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ATM
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5198301
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
Supplier: Log in to see

Individual gRNA against ATM in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Ataxia Telangiectasia Mutated (ATM)
NCBI Accession:
NM_000051
Species:
Human
Synonyms:
tefu, atm, ATM, EDI_100660, CpipJ_CPIJ001772, BDBG_08252, PAAG_02532, MCYG_05088, VDBG_06833, ACLA_015700, AaeL_AAEL014900, MGYG_07634, PGTG_14279, Atm, LOC100349299
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ATM
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5198302
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
Supplier: Log in to see

Individual gRNA against ATP5J in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
ATP Synthase, H+ Transporting, Mitochondrial F0 Complex, Subunit F6 (ATP5J)
NCBI Accession:
NM_001003696
Species:
Human
Synonyms:
atp5j, ATP5J, Atp5j
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ATP5J
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5198340
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
Supplier: Log in to see

Individual gRNA against AGTPBP1 in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
ATP/GTP Binding Protein 1 (AGTPBP1)
NCBI Accession:
NM_015239
Species:
Human
Synonyms:
agtpbp1, AGTPBP1, Agtpbp1
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of AGTPBP1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5198364
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
Supplier: Log in to see

Individual gRNA against CEP72 in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Centrosomal Protein 72kDa (CEP72)
NCBI Accession:
NM_018140
Species:
Human
Synonyms:
CEP72, Cep72, cep72
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of CEP72
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5200602
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
  • <
  • 1
  • ...
  • ...
  • ...
  • ...
  • ...