You are viewing an incomplete version of our website. Please click to reload the website as full version.

CRISPR/ Cas9 Vectors

Here you can find our complete kits for gene knockout via CRISPR. All products are designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.

Components of all CRISPR/ Cas9 kits: 2 guide-RNA vectors to ensure an efficient cleavage. Donor vector containing left and right homologous arms and GFP-Puro functional cassette. Scramble sequence in pCas-Guide vector as negative control.

Browse our high-quality products. For more detailed information regarding a product please download the datasheet. If you need help with finding the right kit, our customer support will gladly help you via live chat, email or phone.

39,144 Products
Type
  • 39144
    Plasmid
Gene
  • 39
  • 8
  • 8
  • 8
  • 6
Species
  • 20116
  • 19014
  • 14
Insert
  • 809074
  • 365420
  • 219740
  • 39144
    gRNA + Cas9
  • 2
Vector
  • 39144
Vector Backbone
  • 39144
Fusion tag
  • 39144
Bacterial Resistance
  • 39144
Promoter
  • 39144
  • 39144
Expression Type
  • 39144
Application
  • 39144
Supplier: Log in to see

Knockout Kit for Human SLU7 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
SLU7 Splicing Factor Homolog (S. Cerevisiae)
Species:
Human
Synonyms:
Slu7, slu7, SLU7
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • SLU7 gRNA vector 1 in pCAS-Guide vector.
  • SLU7 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3223804
$1,260.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human SMAD1 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
SMAD, Mothers Against DPP Homolog 1
Species:
Human
Synonyms:
smad1, SMAD1, Mad, Smad1, smad1-a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • SMAD1 gRNA vector 1 in pCAS-Guide vector.
  • SMAD1 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3223819
$1,260.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human SMAD2 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
SMAD, Mothers Against DPP Homolog 2
Species:
Human
Synonyms:
SMAD2, smad2, Smad2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • SMAD2 gRNA vector 1 in pCAS-Guide vector.
  • SMAD2 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3223821
$1,260.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Mouse (Murine) Smad1 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
SMAD, Mothers Against DPP Homolog 1
Species:
Mouse (Murine)
Synonyms:
smad1, SMAD1, Mad, Smad1, smad1-a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • Smad1 gRNA vector 1 in pCAS-Guide vector.
  • Smad1 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3223820
$1,260.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Mouse (Murine) Rab24 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
RAB24, Member RAS Oncogene Family
Species:
Mouse (Murine)
Synonyms:
RAB24, LOC100356358, rab24, Rab24
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • Rab24 gRNA vector 1 in pCAS-Guide vector.
  • Rab24 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3224308
$1,260.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human SMAD4 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
SMAD Family Member 4
Species:
Human
Synonyms:
SMAD4, smad4, LOC100342294, Smad4, smad4.1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • SMAD4 gRNA vector 1 in pCAS-Guide vector.
  • SMAD4 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3223825
$1,260.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Mouse (Murine) Smad5 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
SMAD, Mothers Against DPP Homolog 5
Species:
Mouse (Murine)
Synonyms:
SMAD5, smad5, smad4.2-b, Smad5
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • Smad5 gRNA vector 1 in pCAS-Guide vector.
  • Smad5 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3223828
$1,260.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Mouse (Murine) Rab25 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
RAB25, Member RAS Oncogene Family
Species:
Mouse (Murine)
Synonyms:
rab25, RAB25, rab25a, LOC100152692, Rab25
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • Rab25 gRNA vector 1 in pCAS-Guide vector.
  • Rab25 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3224310
$1,260.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human RAB26 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
RAB26, Member RAS Oncogene Family
Species:
Human
Synonyms:
Rab26, RAB26, rab26, Rab28
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • RAB26 gRNA vector 1 in pCAS-Guide vector.
  • RAB26 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3224311
$1,260.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human SMAD5 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
SMAD, Mothers Against DPP Homolog 5
Species:
Human
Synonyms:
SMAD5, smad5, smad4.2-b, Smad5
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • SMAD5 gRNA vector 1 in pCAS-Guide vector.
  • SMAD5 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3223827
$1,260.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Mouse (Murine) Smad4 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
SMAD Family Member 4
Species:
Mouse (Murine)
Synonyms:
SMAD4, smad4, LOC100342294, Smad4, smad4.1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • Smad4 gRNA vector 1 in pCAS-Guide vector.
  • Smad4 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3223826
$1,260.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human SMAD7 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
SMAD, Mothers Against DPP Homolog 7
Species:
Human
Synonyms:
SMAD7, Smad7, smad7
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • SMAD7 gRNA vector 1 in pCAS-Guide vector.
  • SMAD7 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3223831
$1,260.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human RAB27A via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
RAB27A, Member RAS Oncogene Family
Species:
Human
Synonyms:
rab27a, RAB27A, rab27a-b, Rab27a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • RAB27A gRNA vector 1 in pCAS-Guide vector.
  • RAB27A gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3224313
$1,260.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human RAB28 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
RAB28, Member RAS Oncogene Family
Species:
Human
Synonyms:
LOC100224739, LOC100344132, RAB28, Rab28
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • RAB28 gRNA vector 1 in pCAS-Guide vector.
  • RAB28 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3224317
$1,260.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Mouse (Murine) Smad7 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
SMAD, Mothers Against DPP Homolog 7
Species:
Mouse (Murine)
Synonyms:
SMAD7, Smad7, smad7
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • Smad7 gRNA vector 1 in pCAS-Guide vector.
  • Smad7 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3223832
$1,260.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human SMAP1 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Stromal Membrane Associated Protein 1
Species:
Human
Synonyms:
Unc45a, Smap1, SMAP1, smap1, PGTG_10041
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • SMAP1 gRNA vector 1 in pCAS-Guide vector.
  • SMAP1 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3223837
$1,260.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human RAB32 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
RAB32, Member RAS Oncogene Family
Species:
Human
Synonyms:
rab32a, rab32, RAB32, LOC100224194, Rab32
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • RAB32 gRNA vector 1 in pCAS-Guide vector.
  • RAB32 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3224327
$1,260.00
1 kit
Will be delivered in 10 to 12 Business Days
Supplier: Log in to see

Knockout Kit for Human RAB31 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
RAB31, Member RAS Oncogene Family
Species:
Human
Synonyms:
RAB31, rab31, Rab31
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • RAB31 gRNA vector 1 in pCAS-Guide vector.
  • RAB31 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3224325
$1,260.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Mouse (Murine) Rab34 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
RAB34, Member RAS Oncogene Family
Species:
Mouse (Murine)
Synonyms:
Rab34, RAB34
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • Rab34 gRNA vector 1 in pCAS-Guide vector.
  • Rab34 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3224334
$1,260.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human SMARCAD1 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
SWI/SNF-Related, Matrix-Associated Actin-Dependent Regulator of Chromatin, Subfamily A, Containing DEAD/H Box 1
Species:
Human
Synonyms:
SMARCAD1, smarcad1, Smarcad1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • SMARCAD1 gRNA vector 1 in pCAS-Guide vector.
  • SMARCAD1 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3223849
$1,260.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human SMARCD1 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
SWI/SNF Related, Matrix Associated, Actin Dependent Regulator of Chromatin, Subfamily D, Member 1
Species:
Human
Synonyms:
SMARCD1, smarcd1, Smarcd1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • SMARCD1 gRNA vector 1 in pCAS-Guide vector.
  • SMARCD1 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3223859
$1,260.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human SMARCD3 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
SWI/SNF Related, Matrix Associated, Actin Dependent Regulator of Chromatin, Subfamily D, Member 3
Species:
Human
Synonyms:
SMARCD3, smarcd3, Smarcd3, smarcd3b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • SMARCD3 gRNA vector 1 in pCAS-Guide vector.
  • SMARCD3 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3223863
$1,260.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human SMARCD2 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
SWI/SNF Related, Matrix Associated, Actin Dependent Regulator of Chromatin, Subfamily D, Member 2
Species:
Human
Synonyms:
SMARCD2, smarcd2, Smarcd2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • SMARCD2 gRNA vector 1 in pCAS-Guide vector.
  • SMARCD2 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3223861
$1,260.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human RAB39B via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
RAB39B, Member RAS Oncogene Family
Species:
Human
Synonyms:
RAB39B, zgc:165464, LOC100221662, LOC100391697, rab39b, Rab39b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • RAB39B gRNA vector 1 in pCAS-Guide vector.
  • RAB39B gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3224345
$1,260.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human RAB3D via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
RAB3D, Member RAS Oncogene Family
Species:
Human
Synonyms:
RAB3D, rab3d, rab3da, Rab3d
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • RAB3D gRNA vector 1 in pCAS-Guide vector.
  • RAB3D gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3224353
$1,260.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human RAB3GAP1 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
RAB3 GTPase Activating Protein Subunit 1 (Catalytic)
Species:
Human
Synonyms:
Rab3gap1, RAB3GAP1, RGD1306487
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • RAB3GAP1 gRNA vector 1 in pCAS-Guide vector.
  • RAB3GAP1 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3224355
$1,260.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human RAB3IL1 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
RAB3A Interacting Protein (Rabin3)-Like 1
Species:
Human
Synonyms:
RAB3IL1, Rab3il1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • RAB3IL1 gRNA vector 1 in pCAS-Guide vector.
  • RAB3IL1 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3224359
$1,260.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human SMC3 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Structural Maintenance of Chromosomes 3
Species:
Human
Synonyms:
smc3, SMC3, Smc3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • SMC3 gRNA vector 1 in pCAS-Guide vector.
  • SMC3 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3223873
$1,260.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human RAB40B via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
RAB40B, Member RAS Oncogene Family
Species:
Human
Synonyms:
rab40b, LOC100344277, RAB40B, Rab40b, RAB40AL
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • RAB40B gRNA vector 1 in pCAS-Guide vector.
  • RAB40B gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3224365
$1,260.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human RAB40C via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
RAB40C, Member RAS Oncogene Family
Species:
Human
Synonyms:
Rab40c, RAB40C, rab40c
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Bacterial Resistance:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • RAB40C gRNA vector 1 in pCAS-Guide vector.
  • RAB40C gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3224367
$1,260.00
1 kit
Will be delivered in 21 Business Days
  • <
  • 1
  • ...
  • ...
  • ...
  • ...