You are viewing an incomplete version of our website. Please click to reload the website as full version.

CRISPR/ Cas9 Vectors

Here you can find our complete kits for gene knockout via CRISPR. All products are designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.

Components of all CRISPR/ Cas9 kits: 2 guide-RNA vectors to ensure an efficient cleavage. Donor vector containing left and right homologous arms and GFP-Puro functional cassette. Scramble sequence in pCas-Guide vector as negative control.

Browse our high-quality products. For more detailed information regarding a product please download the datasheet. If you need help with finding the right kit, our customer support will gladly help you via live chat, email or phone.

154,625 Products
Data Quality
  • 4
Type
  • 154625
    Plasmid
Gene
  • 39
  • 22
  • 18
  • 18
  • 18
Species
  • 61109
  • 60922
  • 32526
  • 58
  • 8
Insert
  • 785884
  • 437354
  • 365420
  • 154625
    gRNA + Cas9
  • 114972
Vector
  • 115481
  • 39144
Vector Backbone
  • 115473
  • 39144
  • 1
  • 1
  • 1
Fusion tag
  • 115477
  • 39144
  • 2
  • 2
Resistance Gene
  • 154625
Selectable Marker
  • 115476
  • 1
Promoter
  • 154617
  • 115473
  • 39144
Expression Type
  • 154625
  • 115478
Application
  • 154625
  • 115473
  • 8
Supplier: Log in to see

Knockout Kit for Human PML via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Promyelocytic Leukemia
Species:
Human
Synonyms:
PML, Pml
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Resistance Gene:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • PML gRNA vector 1 in pCAS-Guide vector.
  • PML gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Publications
  • Xu, Mallon, Roizman: "PML plays both inimical and beneficial roles in HSV-1 replication." in: Proceedings of the National Academy of Sciences of the United States of America, Vol. 113, Issue 21, pp. E3022-8, 2016 (Pubmed)
Catalog No. ABIN3231147
$1,200.00
1 kit
Plus shipping costs $45.00 Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human TMX1 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Thioredoxin-Related Transmembrane Protein 1
Species:
Human
Synonyms:
TMX1, Tmx1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Resistance Gene:
Ampicillin
Promoter:
U6 Promoter,Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • TMX1 gRNA vector 1 in pCAS-Guide vector.
  • TMX1 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Publications
  • Raturi, Gutiérrez, Ortiz-Sandoval, Ruangkittisakul, Herrera-Cruz, Rockley, Gesson, Ourdev, Lou, Lucchinetti, Tahbaz, Zaugg, Baksh, Ballanyi, Simmen: "TMX1 determines cancer cell metabolism as a thiol-based modulator of ER-mitochondria Ca2+ flux." in: The Journal of cell biology, Vol. 214, Issue 4, pp. 433-44, 2016 (Pubmed)
Catalog No. ABIN3258143
$1,200.00
1 kit
Plus shipping costs $45.00 Will be delivered in 10 to 12 Business Days
Supplier: Log in to see

Individual gRNA against ARSE in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Arylsulfatase E
NCBI Accession:
NM_000047
Species:
Human
Synonyms:
ARSE, Arse
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter,SFFV Promoter
Expression:
Stable,Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ARSE
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5199110
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
Supplier: Log in to see

Individual gRNA against DARS in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Aspartyl-tRNA Synthetase
NCBI Accession:
NM_001349
Species:
Human
Synonyms:
dars, DARS, Aats-asp, aspS, RMDY18_09660, Tbis_2053, Slip_0775, Mfer_0591, CKC_01935, Dars, dars-1
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter,SFFV Promoter
Expression:
Stable,Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of DARS
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5199138
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
Supplier: Log in to see

Individual gRNA against ASTN2 in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Astrotactin 2
NCBI Accession:
NM_198187
Species:
Human
Synonyms:
Astn2, ASTN2, astn2
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter,SFFV Promoter
Expression:
Stable,Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ASTN2
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5199150
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
Supplier: Log in to see

Individual gRNA against ATXN10 in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Ataxin 10
NCBI Accession:
NM_013236
Species:
Human
Synonyms:
ATXN10, MGC97716, atxn10, Atxn10
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter,SFFV Promoter
Expression:
Stable,Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ATXN10
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5199160
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
Supplier: Log in to see

Individual gRNA against ATP10D in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
ATPase, Class V, Type 10D
NCBI Accession:
NM_020453
Species:
Human
Synonyms:
ATP10D, atp10d, LOC100356348, Atp10d
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter,SFFV Promoter
Expression:
Stable,Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ATP10D
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5199176
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
Supplier: Log in to see

Individual gRNA against ATP6V0A4 in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
ATPase, H+ Transporting, Lysosomal V0 Subunit A4
NCBI Accession:
NM_020632
Species:
Human
Synonyms:
ATP6V0A4, Atp6v0a4
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter,SFFV Promoter
Expression:
Stable,Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ATP6V0A4
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5199180
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
Supplier: Log in to see

Individual gRNA against Ankrd26 in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Ankyrin Repeat Domain 26
NCBI Accession:
NM_001081112
Species:
Mouse (Murine)
Synonyms:
si:ch211-272n13.3, ANKRD26, Ankrd26
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter,SFFV Promoter
Expression:
Stable,Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Ankrd26
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5198934
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
Supplier: Log in to see

Individual gRNA against ANKH in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Ankylosis, Progressive Homolog (Mouse)
NCBI Accession:
NM_054027
Species:
Human
Synonyms:
ANKH, ankh, Ankh, ankhb, Ank
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter,SFFV Promoter
Expression:
Stable,Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ANKH
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5198936
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
Supplier: Log in to see

Individual gRNA against ANXA9 in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Annexin A9
NCBI Accession:
NM_003568
Species:
Human
Synonyms:
LOC100059291, ANXA9, anxa9, Anxa9
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter,SFFV Promoter
Expression:
Stable,Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ANXA9
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5198978
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
Supplier: Log in to see

Individual gRNA against ANTXR2 in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Anthrax Toxin Receptor 2
NCBI Accession:
NM_001145794
Species:
Human
Synonyms:
ANTXR2, antxr2, Antxr2
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter,SFFV Promoter
Expression:
Stable,Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ANTXR2
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5198990
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
Supplier: Log in to see

Individual gRNA against APOL6 in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Apolipoprotein L, 6
NCBI Accession:
NM_030641
Species:
Human
Synonyms:
APOL6, Apol6
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter,SFFV Promoter
Expression:
Stable,Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of APOL6
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5199018
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
Supplier: Log in to see

Individual gRNA against PRMT2 in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Protein Arginine Methyltransferase 2
NCBI Accession:
NM_001535
Species:
Human
Synonyms:
PRMT2, LOC100356731, Prmt2, prmt2
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter,SFFV Promoter
Expression:
Stable,Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of PRMT2
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5199066
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
Supplier: Log in to see

Individual gRNA against UVRAG in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
UV Radiation Resistance Associated Gene
NCBI Accession:
NM_003369
Species:
Human
Synonyms:
Uvrag, uvrag, UVRAG, Uvrag1
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter,SFFV Promoter
Expression:
Stable,Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of UVRAG
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5199210
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
Supplier: Log in to see

Individual gRNA against GAP43 in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Growth Associated Protein 43
NCBI Accession:
NM_002045
Species:
Human
Synonyms:
LOC733695, Gap43, GAP43, gap43, gap43-a, LOC100345603, gap43-b
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter,SFFV Promoter
Expression:
Stable,Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of GAP43
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5199216
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
Supplier: Log in to see

Individual gRNA against BLK in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
B Lymphoid Tyrosine Kinase
NCBI Accession:
NM_001715
Species:
Human
Synonyms:
blk, BLK, Blk
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter,SFFV Promoter
Expression:
Stable,Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of BLK
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5199222
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
Supplier: Log in to see

Individual gRNA against BANP in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Protein BANP
NCBI Accession:
XM_001718410
Species:
Human
Synonyms:
banp, BANP, Banp
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter,SFFV Promoter
Expression:
Stable,Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of BANP
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5199280
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
Supplier: Log in to see

Individual gRNA against SIL1 in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
SIL1 Homolog, Endoplasmic Reticulum Chaperone (S. Cerevisiae)
NCBI Accession:
NM_001037633
Species:
Human
Synonyms:
Sil1, sil1, SIL1
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter,SFFV Promoter
Expression:
Stable,Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of SIL1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5199286
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
Supplier: Log in to see

Individual gRNA against BARD1 in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
BRCA1 Associated RING Domain 1
NCBI Accession:
NM_000465
Species:
Human
Synonyms:
BARD1, CH211-207D8.3, LOC100229796, bard1, Bard1
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter,SFFV Promoter
Expression:
Stable,Transient
Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of BARD1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5199292
$495.00
300 μL
Plus shipping costs $45.00 and $21.00 dry ice Available
  • <
  • 1
  • ...
  • ...
  • ...
  • ...
  • ...