You are viewing an incomplete version of our website. Please click to reload the website as full version.

cDNA Clones

Complementary DNA or in short cDNA is the product of reverse transcription from an RNA template. Typically, mRNA serves as template for the generation of a cDNA in which its poly-(A) tail is used as a primer site for reverse transcriptase. Subsequently, the cDNA product is amplified by PCR. Usually cDNA does not contain any introns and corresponds oftentimes to the actual coding sequence of gene. As such, cDNA is an important intermediate on the way to expressing a protein of interest. A complete cDNA library of a given organism represents its transcriptome. Derived from mRNA and including 5’ and 3’ UTRs, our cDNA collections are ideal for overexpressing a gene in the context of native regulation.
785,884 Products
Data Quality
  • 2024
  • 785884
  • 229
  • 226
  • 209
  • 165
  • 163
  • 284091
  • 247448
  • 167151
  • 27699
  • 21907
  • 785884
  • 437354
  • 365420
  • 154625
  • 114972
  • 442105
  • 247251
  • 87095
  • 9413
  • 20
Vector Backbone
  • 62463
  • 62462
  • 62462
  • 62462
  • 61225
Fusion tag
  • 291240
  • 187387
  • 62462
  • 61225
  • 61224
Resistance Gene
  • 563556
  • 199160
  • 23502
Selectable Marker
  • 335062
  • 14372
  • 62
  • 5
  • 1
  • 264113
  • 247373
  • 182023
  • 9106
  • 803
Expression Type
  • 438772
  • 247429
  • 4227
  • 3174
  • 10
  • 462721
  • 442125
  • 20
Supplier: Log in to see

Untagged full-length cDNA clone from Human IL8 is ideal for over-expression of native protein for functional studies.

Protein Expression
Interleukin 8
NCBI Accession:
NM_000584, NP_000575
IL8L1, il8, IL8, LOC422654, Cxcl15, Il8, IL8L2, IL*08-02
Insert length:
1690 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter,T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Balakathiresan, Bhattacharyya, Gutti, Long, Jozwik, Huang, Srivastava, Pollard, Biswas: "Tristetraprolin regulates IL-8 mRNA stability in cystic fibrosis lung epithelial cells." in: American journal of physiology. Lung cellular and molecular physiology, Vol. 296, Issue 6, pp. L1012-8, 2009 (Pubmed)
Catalog No. ABIN3384619
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human MDH1 is ideal for over-expression of native protein for functional studies.

Protein Expression
Malate Dehydrogenase 1, NAD (Soluble)
NCBI Accession:
NM_005917, NP_005908
mdh5, LOC100280767, Mdh1, MDH1, mdh1
Insert length:
1370 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter,T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Stiebler, Freitag, Schink, Stehlik, Tillmann, Ast, Bölker: "Ribosomal readthrough at a short UGA stop codon context triggers dual localization of metabolic enzymes in Fungi and animals." in: PLoS genetics, Vol. 10, Issue 10, pp. e1004685, 2014 (Pubmed)
Catalog No. ABIN3385064
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human LOX is ideal for over-expression of native protein for functional studies.

Protein Expression
Lysyl Oxidase
NCBI Accession:
NM_002317, NP_002308
LOX, lox, Lox, LOC100357045
Insert length:
1870 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter,T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Ruiz, Báez-Vega, Ruiz, Peterse, Monteiro, Bracero, Beauchamp, Fazleabas, Flores: "Dysregulation of Lysyl Oxidase Expression in Lesions and Endometrium of Women With Endometriosis." in: Reproductive sciences (Thousand Oaks, Calif.), Vol. 22, Issue 12, pp. 1496-508, 2015 (Pubmed)
  • Okkelman, Sukaeva, Kirukhina, Korneenko, Pestov: "Nuclear translocation of lysyl oxidase is promoted by interaction with transcription repressor p66β." in: Cell and tissue research, Vol. 358, Issue 2, pp. 481-9, 2014 (Pubmed)
Catalog No. ABIN3384901
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human LOXL2 is ideal for over-expression of native protein for functional studies.

Protein Expression
Lysyl Oxidase-Like 2
NCBI Accession:
NM_002318, NP_002309
lox2, LOXL2, loxl2, Loxl2
Insert length:
3550 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter,T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • de Jong, van Balkom, Gremmels, Verhaar: "Exosomes from hypoxic endothelial cells have increased collagen crosslinking activity through up-regulation of lysyl oxidase-like 2." in: Journal of cellular and molecular medicine, Vol. 20, Issue 2, pp. 342-50, 2016 (Pubmed)
  • Wong, Tse, Huang, Zhu, Chiu, Lai, Au, Kai, Lee, Wei, Tsang, Lo, Shi, Zheng, Wong, Ng: "Lysyl oxidase-like 2 is critical to tumor microenvironment and metastatic niche formation in hepatocellular carcinoma." in: Hepatology (Baltimore, Md.), Vol. 60, Issue 5, pp. 1645-58, 2014 (Pubmed)
  • Xu, Go, Finney, Moon, Lantz, Rebecchi, Desaire, Mure: "Post-translational modifications of recombinant human lysyl oxidase-like 2 (rhLOXL2) secreted from Drosophila S2 cells." in: The Journal of biological chemistry, Vol. 288, Issue 8, pp. 5357-63, 2013 (Pubmed)
  • Bignon, Pichol-Thievend, Hardouin, Malbouyres, Bréchot, Nasciutti, Barret, Teillon, Guillon, Etienne, Caron, Joubert-Caron, Monnot, Ruggiero, Muller, Germain: "Lysyl oxidase-like protein-2 regulates sprouting angiogenesis and type IV collagen assembly in the endothelial basement membrane." in: Blood, Vol. 118, Issue 14, pp. 3979-89, 2011 (Pubmed)
Catalog No. ABIN3384902
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human MAT2A is ideal for over-expression of native protein for functional studies.

Protein Expression
Methionine Adenosyltransferase II, alpha
NCBI Accession:
NM_005911, NP_005902
mat2a, MAT2A, Mat2a, mat2aa
Insert length:
2820 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter,T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Nordgren, Peng, Pelleymounter, Moon, Abo, Feng, Eckloff, Yee, Wieben, Weinshilboum: "Methionine adenosyltransferase 2A/2B and methylation: gene sequence variation and functional genomics." in: Drug metabolism and disposition: the biological fate of chemicals, Vol. 39, Issue 11, pp. 2135-47, 2011 (Pubmed)
Catalog No. ABIN3385037
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human MAX is ideal for over-expression of native protein for functional studies.

Protein Expression
MYC Associated Factor X
NCBI Accession:
NM_145112, NP_660087
Max, max-a, MAX, max, max-b
Insert length:
2210 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter,T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Ikeda, Pak, Chavez, Ryan: "Transcription factors with conserved binding sites near ATOH1 on the POU4F3 gene enhance the induction of cochlear hair cells." in: Molecular neurobiology, Vol. 51, Issue 2, pp. 672-84, 2015 (Pubmed)
Catalog No. ABIN3385041
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human MCCC1 is ideal for over-expression of native protein for functional studies.

Protein Expression
Methylcrotonoyl-CoA Carboxylase 1 (Alpha)
NCBI Accession:
NM_020166, NP_064551
MCCC1, Mccc1, MCCA
Insert length:
2620 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter,T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Ingaramo, Beckett: "Selectivity in post-translational biotin addition to five human carboxylases." in: The Journal of biological chemistry, Vol. 287, Issue 3, pp. 1813-22, 2012 (Pubmed)
Catalog No. ABIN3385055
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human PSMC5 is ideal for over-expression of native protein for functional studies.

Protein Expression
Proteasome (Prosome, Macropain) 26S Subunit, ATPase, 5
NCBI Accession:
NM_002805, NP_002796
Psmc5, PSMC5, psmc5, TBP10
Insert length:
1430 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter,T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Chen, Laurenzana, Coslo, Chen, Omiecinski: "Proteasomal interaction as a critical activity modulator of the human constitutive androstane receptor." in: The Biochemical journal, Vol. 458, Issue 1, pp. 95-107, 2014 (Pubmed)
Catalog No. ABIN3386114
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human RBBP9 is ideal for over-expression of native protein for functional studies.

Protein Expression
Retinoblastoma Binding Protein 9
NCBI Accession:
NM_006606, NP_006597
RBBP9, rbbp9, Rbbp9
Insert length:
2590 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter,T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Shields, Niessen, Murphy, Mielgo, Desgrosellier, Lau, Barnes, Lesperance, Bouvet, Tarin, Cravatt, Cheresh: "RBBP9: a tumor-associated serine hydrolase activity required for pancreatic neoplasia." in: Proceedings of the National Academy of Sciences of the United States of America, Vol. 107, Issue 5, pp. 2189-94, 2010 (Pubmed)
Catalog No. ABIN3386291
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human PTBP2 is ideal for over-expression of native protein for functional studies.

Protein Expression
Polypyrimidine Tract Binding Protein 2
NCBI Accession:
NM_021190, NP_067013
PTBP2, LOC100349676, Ptbp2, ptbp2b
Insert length:
3460 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter,T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Yip, Fuhlbrigge, Taylor, Creusot, Nishikawa-Matsumura, Whiting, Schartner, Akter, von Herrath, Fathman: "Inflammation and hyperglycemia mediate Deaf1 splicing in the pancreatic lymph nodes via distinct pathways during type 1 diabetes." in: Diabetes, Vol. 64, Issue 2, pp. 604-17, 2015 (Pubmed)
Catalog No. ABIN3386141
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human RGS4 is ideal for over-expression of native protein for functional studies.

Protein Expression
Regulator of G-Protein Signaling 4
NCBI Accession:
NM_005613, NP_005604
RGS4, Rgs4
Insert length:
2740 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter,T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Iankova, Chavey, Clapé, Colomer, Guérineau, Grillet, Brunet, Annicotte, Fajas: "Regulator of G protein signaling-4 controls fatty acid and glucose homeostasis." in: Endocrinology, Vol. 149, Issue 11, pp. 5706-12, 2008 (Pubmed)
Catalog No. ABIN3386364
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human RNF139 is ideal for over-expression of native protein for functional studies.

Protein Expression
Ring Finger Protein 139
NCBI Accession:
NM_007218, NP_009149
RNF139, Rnf139
Insert length:
2500 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter,T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Lin, Lan, Chau: "TRC8 suppresses tumorigenesis through targeting heme oxygenase-1 for ubiquitination and degradation." in: Oncogene, Vol. 32, Issue 18, pp. 2325-34, 2013 (Pubmed)
Catalog No. ABIN3386406
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human RPE65 is ideal for over-expression of native protein for functional studies.

Protein Expression
Retinal Pigment Epithelium-Specific Protein 65kDa
NCBI Accession:
NM_000329, NP_000320
rpe65c, LOC100219959, LOC100352270, Rpe65, RPE65
Insert length:
2780 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter,T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Bavik, Henry, Zhang, Mitts, McGinn, Budzynski, Pashko, Lieu, Zhong, Blumberg, Kuksa, Orme, Scott, Fawzi, Kubota: "Visual Cycle Modulation as an Approach toward Preservation of Retinal Integrity." in: PLoS ONE, Vol. 10, Issue 5, pp. e0124940, 2015 (Pubmed)
Catalog No. ABIN3386437
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human SLC22A2 is ideal for over-expression of native protein for functional studies.

Protein Expression
Solute Carrier Family 22 (Organic Cation Transporter), Member 2
NCBI Accession:
NM_003058, NP_003049
OCT2, SLC22A2, Slc22a2
Insert length:
2400 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter,T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Wang, Sun, Li, Tu, Jiang: "Involvement of organic cation transporter 2 inhibition in potential mechanisms of antidepressant action." in: Progress in neuro-psychopharmacology & biological psychiatry, Vol. 53, Issue , pp. 90-8, 2014 (Pubmed)
  • Sprowl, Ciarimboli, Lancaster, Giovinazzo, Gibson, Du, Janke, Cavaletti, Shields, Sparreboom: "Oxaliplatin-induced neurotoxicity is dependent on the organic cation transporter OCT2." in: Proceedings of the National Academy of Sciences of the United States of America, Vol. 110, Issue 27, pp. 11199-204, 2013 (Pubmed)
  • Filipski, Loos, Verweij, Sparreboom: "Interaction of Cisplatin with the human organic cation transporter 2." in: Clinical cancer research : an official journal of the American Association for Cancer Research, Vol. 14, Issue 12, pp. 3875-80, 2008 (Pubmed)
Catalog No. ABIN3386748
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human RRM1 is ideal for over-expression of native protein for functional studies.

Protein Expression
Ribonucleotide Reductase M1
NCBI Accession:
NM_001033, NP_001024
RRM1, RnrL, rrm1, Rrm1
Insert length:
2930 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter,T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Xie, Yen, Owonikoko, Ramalingam, Khuri, Curran, Doetsch, Deng: "Bcl2 induces DNA replication stress by inhibiting ribonucleotide reductase." in: Cancer research, Vol. 74, Issue 1, pp. 212-23, 2014 (Pubmed)
Catalog No. ABIN3386533
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human SMAD1 is ideal for over-expression of native protein for functional studies.

Protein Expression
SMAD, Mothers Against DPP Homolog 1
NCBI Accession:
NM_005900, NP_005891
smad1, SMAD1, Mad, Smad1, smad1-a
Insert length:
2000 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter,T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Trinh, Barengo, Naora: "Homeodomain protein DLX4 counteracts key transcriptional control mechanisms of the TGF-? cytostatic program and blocks the antiproliferative effect of TGF-?." in: Oncogene, Vol. 30, Issue 24, pp. 2718-29, 2011 (Pubmed)
Catalog No. ABIN3386826
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human SMAD4 is ideal for over-expression of native protein for functional studies.

Protein Expression
SMAD Family Member 4
NCBI Accession:
NM_005359, NP_005350
SMAD4, smad4, LOC100342294, Smad4, smad4.1
Insert length:
3570 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter,T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Tone, Furuuchi, Kojima, Tykocinski, Greene, Tone: "Smad3 and NFAT cooperate to induce Foxp3 expression through its enhancer." in: Nature immunology, Vol. 9, Issue 2, pp. 194-202, 2008 (Pubmed)
Catalog No. ABIN3386828
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human SGCE is ideal for over-expression of native protein for functional studies.

Protein Expression
Sarcoglycan, epsilon
NCBI Accession:
NM_003919, NP_003910
sgce, SGCE, Sgce
Insert length:
1470 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter,T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Esapa, Waite, Locke, Benson, Kraus, McIlhinney, Sillitoe, Beesley, Blake: "SGCE missense mutations that cause myoclonus-dystonia syndrome impair epsilon-sarcoglycan trafficking to the plasma membrane: modulation by ubiquitination and torsinA." in: Human molecular genetics, Vol. 16, Issue 3, pp. 327-42, 2007 (Pubmed)
Catalog No. ABIN3386694
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human SGK1 is ideal for over-expression of native protein for functional studies.

Protein Expression
serum/glucocorticoid Regulated Kinase 1
NCBI Accession:
NM_005627, NP_005618
SGK1, Sgk1, sgk1
Insert length:
2560 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter,T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Zhong, Oguljahan, Xiao, Nelson, Hernandez, Garcia-Barrio, Francis: "Serum and glucocorticoid-regulated kinase 1 promotes vascular smooth muscle cell proliferation via regulation of β-catenin dynamics." in: Cellular signalling, Vol. 26, Issue 12, pp. 2765-72, 2014 (Pubmed)
  • Chen, Tagliaferro, Kareva, Yarygina, Kholodilov, Burke: "Neurotrophic effects of serum- and glucocorticoid-inducible kinase on adult murine mesencephalic dopamine neurons." in: The Journal of neuroscience : the official journal of the Society for Neuroscience, Vol. 32, Issue 33, pp. 11299-308, 2012 (Pubmed)
  • Arteaga, Alvarez de la Rosa, Alvarez, Canessa: "Multiple translational isoforms give functional specificity to serum- and glucocorticoid-induced kinase 1." in: Molecular biology of the cell, Vol. 18, Issue 6, pp. 2072-80, 2007 (Pubmed)
Catalog No. ABIN3386695
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human SAE1 is ideal for over-expression of native protein for functional studies.

Protein Expression
SUMO1 Activating Enzyme Subunit 1
NCBI Accession:
NM_005500, NP_005491
ARHGAP31, SAE1, Sae1, sae1
Insert length:
2050 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter,T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Kho, Lee, Jeong, Oh, Gorski, Fish, Sanchez, DeVita, Christensen, Dahl, Hajjar: "Small-molecule activation of SERCA2a SUMOylation for the treatment of heart failure." in: Nature communications, Vol. 6, Issue , pp. 7229, 2015 (Pubmed)
Catalog No. ABIN3386574
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
  • <
  • 1
  • ...
  • ...
  • ...
  • ...
  • ...