You are viewing an incomplete version of our website. Please click to reload the website as full version.

cDNA Clones

Complementary DNA or in short cDNA is the product of reverse transcription from an RNA template. Typically, mRNA serves as template for the generation of a cDNA in which its poly-(A) tail is used as a primer site for reverse transcriptase. Subsequently, the cDNA product is amplified by PCR. Usually cDNA does not contain any introns and corresponds oftentimes to the actual coding sequence of gene. As such, cDNA is an important intermediate on the way to expressing a protein of interest. A complete cDNA library of a given organism represents its transcriptome. Derived from mRNA and including 5’ and 3’ UTRs, our cDNA collections are ideal for overexpressing a gene in the context of native regulation.
785,868 Products
Data Quality
  • 2024
Type
  • 785868
    Plasmid
Gene
  • 229
  • 226
  • 209
  • 165
  • 163
Species
  • 284091
  • 247452
  • 167151
  • 27699
  • 21907
Insert
  • 785868
    cDNA
  • 365420
  • 249950
  • 39144
  • 37846
Vector
  • 442107
  • 247253
  • 87095
  • 9413
Vector Backbone
  • 62464
  • 62463
  • 62463
  • 62463
  • 61225
Fusion tag
  • 291230
  • 187390
  • 62463
  • 61225
  • 61224
Bacterial Resistance
  • 563560
  • 199140
  • 23502
Selectable Marker
  • 335064
  • 14372
  • 57
  • 1
Promoter
  • 264115
  • 247375
  • 182023
  • 9106
  • 803
Expression Type
  • 438754
  • 247431
  • 4217
  • 3174
  • 10
Application
  • 462723
  • 442107
Supplier: Log in to see

Untagged full-length cDNA clone from Human IL8 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Interleukin 8
NCBI Accession:
NM_000584, NP_000575
Species:
Human
Synonyms:
IL8L1, il8, IL8, LOC422654, Cxcl15, Il8, IL8L2, IL*08-02
Insert length:
1690 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Bacterial Resistance:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Balakathiresan, Bhattacharyya, Gutti, Long, Jozwik, Huang, Srivastava, Pollard, Biswas: "Tristetraprolin regulates IL-8 mRNA stability in cystic fibrosis lung epithelial cells." in: American journal of physiology. Lung cellular and molecular physiology, Vol. 296, Issue 6, pp. L1012-8, 2009 (Pubmed)
Catalog No. ABIN3384619
$190.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human MDH1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Malate Dehydrogenase 1, NAD (Soluble)
NCBI Accession:
NM_005917, NP_005908
Species:
Human
Synonyms:
mdh5, LOC100280767, Mdh1, MDH1, mdh1
Insert length:
1370 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Bacterial Resistance:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Stiebler, Freitag, Schink, Stehlik, Tillmann, Ast, Bölker: "Ribosomal readthrough at a short UGA stop codon context triggers dual localization of metabolic enzymes in Fungi and animals." in: PLoS genetics, Vol. 10, Issue 10, pp. e1004685, 2014 (Pubmed)
Catalog No. ABIN3385064
$190.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human LOX is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Lysyl Oxidase
NCBI Accession:
NM_002317, NP_002308
Species:
Human
Synonyms:
LOX, lox, Lox, LOC100357045
Insert length:
1870 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Bacterial Resistance:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Ruiz, Báez-Vega, Ruiz, Peterse, Monteiro, Bracero, Beauchamp, Fazleabas, Flores: "Dysregulation of Lysyl Oxidase Expression in Lesions and Endometrium of Women With Endometriosis." in: Reproductive sciences (Thousand Oaks, Calif.), Vol. 22, Issue 12, pp. 1496-508, 2015 (Pubmed)
  • Okkelman, Sukaeva, Kirukhina, Korneenko, Pestov: "Nuclear translocation of lysyl oxidase is promoted by interaction with transcription repressor p66β." in: Cell and tissue research, Vol. 358, Issue 2, pp. 481-9, 2014 (Pubmed)
Catalog No. ABIN3384901
$190.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human LOXL2 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Lysyl Oxidase-Like 2
NCBI Accession:
NM_002318, NP_002309
Species:
Human
Synonyms:
lox2, LOXL2, loxl2, Loxl2
Insert length:
3550 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Bacterial Resistance:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • de Jong, van Balkom, Gremmels, Verhaar: "Exosomes from hypoxic endothelial cells have increased collagen crosslinking activity through up-regulation of lysyl oxidase-like 2." in: Journal of cellular and molecular medicine, Vol. 20, Issue 2, pp. 342-50, 2016 (Pubmed)
  • Wong, Tse, Huang, Zhu, Chiu, Lai, Au, Kai, Lee, Wei, Tsang, Lo, Shi, Zheng, Wong, Ng: "Lysyl oxidase-like 2 is critical to tumor microenvironment and metastatic niche formation in hepatocellular carcinoma." in: Hepatology (Baltimore, Md.), Vol. 60, Issue 5, pp. 1645-58, 2014 (Pubmed)
  • Xu, Go, Finney, Moon, Lantz, Rebecchi, Desaire, Mure: "Post-translational modifications of recombinant human lysyl oxidase-like 2 (rhLOXL2) secreted from Drosophila S2 cells." in: The Journal of biological chemistry, Vol. 288, Issue 8, pp. 5357-63, 2013 (Pubmed)
  • Bignon, Pichol-Thievend, Hardouin, Malbouyres, Bréchot, Nasciutti, Barret, Teillon, Guillon, Etienne, Caron, Joubert-Caron, Monnot, Ruggiero, Muller, Germain: "Lysyl oxidase-like protein-2 regulates sprouting angiogenesis and type IV collagen assembly in the endothelial basement membrane." in: Blood, Vol. 118, Issue 14, pp. 3979-89, 2011 (Pubmed)
Catalog No. ABIN3384902
$190.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human MAT2A is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Methionine Adenosyltransferase II, alpha
NCBI Accession:
NM_005911, NP_005902
Species:
Human
Synonyms:
mat2a, MAT2A, Mat2a, mat2aa
Insert length:
2820 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Bacterial Resistance:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Nordgren, Peng, Pelleymounter, Moon, Abo, Feng, Eckloff, Yee, Wieben, Weinshilboum: "Methionine adenosyltransferase 2A/2B and methylation: gene sequence variation and functional genomics." in: Drug metabolism and disposition: the biological fate of chemicals, Vol. 39, Issue 11, pp. 2135-47, 2011 (Pubmed)
Catalog No. ABIN3385037
$190.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human MAX is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
MYC Associated Factor X
NCBI Accession:
NM_145112, NP_660087
Species:
Human
Synonyms:
Max, max-a, MAX, max, max-b
Insert length:
2210 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Bacterial Resistance:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Ikeda, Pak, Chavez, Ryan: "Transcription factors with conserved binding sites near ATOH1 on the POU4F3 gene enhance the induction of cochlear hair cells." in: Molecular neurobiology, Vol. 51, Issue 2, pp. 672-84, 2015 (Pubmed)
Catalog No. ABIN3385041
$190.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human MCCC1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Methylcrotonoyl-CoA Carboxylase 1 (Alpha)
NCBI Accession:
NM_020166, NP_064551
Species:
Human
Synonyms:
MCCC1, Mccc1, MCCA
Insert length:
2620 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Bacterial Resistance:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Ingaramo, Beckett: "Selectivity in post-translational biotin addition to five human carboxylases." in: The Journal of biological chemistry, Vol. 287, Issue 3, pp. 1813-22, 2012 (Pubmed)
Catalog No. ABIN3385055
$190.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human PSMC5 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Proteasome (Prosome, Macropain) 26S Subunit, ATPase, 5
NCBI Accession:
NM_002805, NP_002796
Species:
Human
Synonyms:
Psmc5, PSMC5, psmc5, TBP10
Insert length:
1430 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Bacterial Resistance:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Chen, Laurenzana, Coslo, Chen, Omiecinski: "Proteasomal interaction as a critical activity modulator of the human constitutive androstane receptor." in: The Biochemical journal, Vol. 458, Issue 1, pp. 95-107, 2014 (Pubmed)
Catalog No. ABIN3386114
$190.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human RBBP9 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Retinoblastoma Binding Protein 9
NCBI Accession:
NM_006606, NP_006597
Species:
Human
Synonyms:
RBBP9, rbbp9, Rbbp9
Insert length:
2590 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Bacterial Resistance:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Shields, Niessen, Murphy, Mielgo, Desgrosellier, Lau, Barnes, Lesperance, Bouvet, Tarin, Cravatt, Cheresh: "RBBP9: a tumor-associated serine hydrolase activity required for pancreatic neoplasia." in: Proceedings of the National Academy of Sciences of the United States of America, Vol. 107, Issue 5, pp. 2189-94, 2010 (Pubmed)
Catalog No. ABIN3386291
$190.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human PTBP2 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Polypyrimidine Tract Binding Protein 2
NCBI Accession:
NM_021190, NP_067013
Species:
Human
Synonyms:
PTBP2, LOC100349676, Ptbp2, ptbp2b
Insert length:
3460 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Bacterial Resistance:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Yip, Fuhlbrigge, Taylor, Creusot, Nishikawa-Matsumura, Whiting, Schartner, Akter, von Herrath, Fathman: "Inflammation and hyperglycemia mediate Deaf1 splicing in the pancreatic lymph nodes via distinct pathways during type 1 diabetes." in: Diabetes, Vol. 64, Issue 2, pp. 604-17, 2015 (Pubmed)
Catalog No. ABIN3386141
$190.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human RGS4 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Regulator of G-Protein Signaling 4
NCBI Accession:
NM_005613, NP_005604
Species:
Human
Synonyms:
RGS4, Rgs4
Insert length:
2740 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Bacterial Resistance:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Iankova, Chavey, Clapé, Colomer, Guérineau, Grillet, Brunet, Annicotte, Fajas: "Regulator of G protein signaling-4 controls fatty acid and glucose homeostasis." in: Endocrinology, Vol. 149, Issue 11, pp. 5706-12, 2008 (Pubmed)
Catalog No. ABIN3386364
$190.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human RNF139 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Ring Finger Protein 139
NCBI Accession:
NM_007218, NP_009149
Species:
Human
Synonyms:
RNF139, Rnf139
Insert length:
2500 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Bacterial Resistance:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Lin, Lan, Chau: "TRC8 suppresses tumorigenesis through targeting heme oxygenase-1 for ubiquitination and degradation." in: Oncogene, Vol. 32, Issue 18, pp. 2325-34, 2013 (Pubmed)
Catalog No. ABIN3386406
$190.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human RPE65 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Retinal Pigment Epithelium-Specific Protein 65kDa
NCBI Accession:
NM_000329, NP_000320
Species:
Human
Synonyms:
rpe65c, LOC100219959, LOC100352270, Rpe65, RPE65
Insert length:
2780 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Bacterial Resistance:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Bavik, Henry, Zhang, Mitts, McGinn, Budzynski, Pashko, Lieu, Zhong, Blumberg, Kuksa, Orme, Scott, Fawzi, Kubota: "Visual Cycle Modulation as an Approach toward Preservation of Retinal Integrity." in: PLoS ONE, Vol. 10, Issue 5, pp. e0124940, 2015 (Pubmed)
Catalog No. ABIN3386437
$190.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human SLC22A2 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Solute Carrier Family 22 (Organic Cation Transporter), Member 2
NCBI Accession:
NM_003058, NP_003049
Species:
Human
Synonyms:
OCT2, SLC22A2, Slc22a2
Insert length:
2400 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Bacterial Resistance:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Wang, Sun, Li, Tu, Jiang: "Involvement of organic cation transporter 2 inhibition in potential mechanisms of antidepressant action." in: Progress in neuro-psychopharmacology & biological psychiatry, Vol. 53, Issue , pp. 90-8, 2014 (Pubmed)
  • Sprowl, Ciarimboli, Lancaster, Giovinazzo, Gibson, Du, Janke, Cavaletti, Shields, Sparreboom: "Oxaliplatin-induced neurotoxicity is dependent on the organic cation transporter OCT2." in: Proceedings of the National Academy of Sciences of the United States of America, Vol. 110, Issue 27, pp. 11199-204, 2013 (Pubmed)
  • Filipski, Loos, Verweij, Sparreboom: "Interaction of Cisplatin with the human organic cation transporter 2." in: Clinical cancer research : an official journal of the American Association for Cancer Research, Vol. 14, Issue 12, pp. 3875-80, 2008 (Pubmed)
Catalog No. ABIN3386748
$190.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human RRM1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Ribonucleotide Reductase M1
NCBI Accession:
NM_001033, NP_001024
Species:
Human
Synonyms:
RRM1, RnrL, rrm1, Rrm1
Insert length:
2930 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Bacterial Resistance:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Xie, Yen, Owonikoko, Ramalingam, Khuri, Curran, Doetsch, Deng: "Bcl2 induces DNA replication stress by inhibiting ribonucleotide reductase." in: Cancer research, Vol. 74, Issue 1, pp. 212-23, 2014 (Pubmed)
Catalog No. ABIN3386533
$190.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human SMAD1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
SMAD, Mothers Against DPP Homolog 1
NCBI Accession:
NM_005900, NP_005891
Species:
Human
Synonyms:
smad1, SMAD1, Mad, Smad1, smad1-a
Insert length:
2000 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Bacterial Resistance:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Trinh, Barengo, Naora: "Homeodomain protein DLX4 counteracts key transcriptional control mechanisms of the TGF-? cytostatic program and blocks the antiproliferative effect of TGF-?." in: Oncogene, Vol. 30, Issue 24, pp. 2718-29, 2011 (Pubmed)
Catalog No. ABIN3386826
$190.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human SMAD4 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
SMAD Family Member 4
NCBI Accession:
NM_005359, NP_005350
Species:
Human
Synonyms:
SMAD4, smad4, LOC100342294, Smad4, smad4.1
Insert length:
3570 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Bacterial Resistance:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Tone, Furuuchi, Kojima, Tykocinski, Greene, Tone: "Smad3 and NFAT cooperate to induce Foxp3 expression through its enhancer." in: Nature immunology, Vol. 9, Issue 2, pp. 194-202, 2008 (Pubmed)
Catalog No. ABIN3386828
$190.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human SGCE is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Sarcoglycan, epsilon
NCBI Accession:
NM_003919, NP_003910
Species:
Human
Synonyms:
sgce, SGCE, Sgce
Insert length:
1470 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Bacterial Resistance:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Esapa, Waite, Locke, Benson, Kraus, McIlhinney, Sillitoe, Beesley, Blake: "SGCE missense mutations that cause myoclonus-dystonia syndrome impair epsilon-sarcoglycan trafficking to the plasma membrane: modulation by ubiquitination and torsinA." in: Human molecular genetics, Vol. 16, Issue 3, pp. 327-42, 2007 (Pubmed)
Catalog No. ABIN3386694
$190.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human SGK1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
serum/glucocorticoid Regulated Kinase 1
NCBI Accession:
NM_005627, NP_005618
Species:
Human
Synonyms:
SGK1, Sgk1, sgk1
Insert length:
2560 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Bacterial Resistance:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Zhong, Oguljahan, Xiao, Nelson, Hernandez, Garcia-Barrio, Francis: "Serum and glucocorticoid-regulated kinase 1 promotes vascular smooth muscle cell proliferation via regulation of β-catenin dynamics." in: Cellular signalling, Vol. 26, Issue 12, pp. 2765-72, 2014 (Pubmed)
  • Chen, Tagliaferro, Kareva, Yarygina, Kholodilov, Burke: "Neurotrophic effects of serum- and glucocorticoid-inducible kinase on adult murine mesencephalic dopamine neurons." in: The Journal of neuroscience : the official journal of the Society for Neuroscience, Vol. 32, Issue 33, pp. 11299-308, 2012 (Pubmed)
  • Arteaga, Alvarez de la Rosa, Alvarez, Canessa: "Multiple translational isoforms give functional specificity to serum- and glucocorticoid-induced kinase 1." in: Molecular biology of the cell, Vol. 18, Issue 6, pp. 2072-80, 2007 (Pubmed)
Catalog No. ABIN3386695
$190.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human SAE1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
SUMO1 Activating Enzyme Subunit 1
NCBI Accession:
NM_005500, NP_005491
Species:
Human
Synonyms:
ARHGAP31, SAE1, Sae1, sae1
Insert length:
2050 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Bacterial Resistance:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Kho, Lee, Jeong, Oh, Gorski, Fish, Sanchez, DeVita, Christensen, Dahl, Hajjar: "Small-molecule activation of SERCA2a SUMOylation for the treatment of heart failure." in: Nature communications, Vol. 6, Issue , pp. 7229, 2015 (Pubmed)
Catalog No. ABIN3386574
$190.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human SATB1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
SATB Homeobox 1
NCBI Accession:
NM_002971, NP_002962
Species:
Human
Synonyms:
SATB1, satb1, Satb1
Insert length:
2820 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Bacterial Resistance:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Grzanka, Izdebska, Klimaszewska-Wisniewska, Gagat: "The alterations in SATB1 and nuclear F-actin expression affect apoptotic response of the MCF-7 cells to geldanamycin." in: Folia histochemica et cytobiologica, Vol. 53, Issue 1, pp. 79-87, 2015 (Pubmed)
  • Grzanka, Kowalczyk, Izdebska, Klimaszewska-Wisniewska, Gagat: "The interactions between SATB1 and F-actin are important for mechanisms of active cell death." in: Folia histochemica et cytobiologica, Vol. 53, Issue 2, pp. 152-61, 2015 (Pubmed)
  • Nagpal, Ahmad, Molparia, Kulshreshtha: "MicroRNA-191, an estrogen-responsive microRNA, functions as an oncogenic regulator in human breast cancer." in: Carcinogenesis, Vol. 34, Issue 8, pp. 1889-99, 2013 (Pubmed)
  • Wang, Su, Zhou, Tu, Zhang, Jiang, Zhou: "Deficiency of SATB1 expression in Sezary cells causes apoptosis resistance by regulating FasL/CD95L transcription." in: Blood, Vol. 117, Issue 14, pp. 3826-35, 2011 (Pubmed)
Catalog No. ABIN3386585
$190.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human SCD is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Stearoyl-CoA Desaturase (Delta-9-Desaturase)
NCBI Accession:
NM_005063, NP_005054
Species:
Human
Synonyms:
scd, SCD, Desat1, Desat3, CIMG_08158, VIBHAR_06094, acod, LOC100346561, Scd, Scd1, SCD1
Insert length:
5150 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Bacterial Resistance:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Lu, Zhou, Tao, Dou, Gao, Liu: "Overexpression of stearoyl-CoA desaturase 1 in bone marrow mesenchymal stem cells enhance the expression of induced endothelial cells." in: Lipids in health and disease, Vol. 13, Issue , pp. 53, 2014 (Pubmed)
Catalog No. ABIN3386597
$190.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human RNF13 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Ring Finger Protein 13
NCBI Accession:
NM_007282, NP_009213
Species:
Human
Synonyms:
RNF13, Rnf13, rnf13
Insert length:
2360 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Bacterial Resistance:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • van Dijk, Yamazaki, Palmer: "Tumour-associated mutations of PA-TM-RING ubiquitin ligases RNF167/RNF13 identify the PA domain as a determinant for endosomal localization." in: The Biochemical journal, Vol. 459, Issue 1, pp. 27-36, 2014 (Pubmed)
Catalog No. ABIN3386403
$190.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human SLC33A1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Solute Carrier Family 33 Member 1
NCBI Accession:
NM_004733, NP_004724
Species:
Human
Synonyms:
slc33a1, SLC33A1, Slc33a1
Insert length:
2640 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Bacterial Resistance:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Peng, Li, Clarkson, Pehar, Lao, Hillmer, Barnhart, Christian, Mitchell, Bendlin, Sandor, Puglielli: "Deficient import of acetyl-CoA into the ER lumen causes neurodegeneration and propensity to infections, inflammation, and cancer." in: The Journal of neuroscience : the official journal of the Society for Neuroscience, Vol. 34, Issue 20, pp. 6772-89, 2014 (Pubmed)
  • Pehar, Jonas, Hare, Puglielli: "SLC33A1/AT-1 protein regulates the induction of autophagy downstream of IRE1/XBP1 pathway." in: The Journal of biological chemistry, Vol. 287, Issue 35, pp. 29921-30, 2012 (Pubmed)
  • Jonas, Pehar, Puglielli: "AT-1 is the ER membrane acetyl-CoA transporter and is essential for cell viability." in: Journal of cell science, Vol. 123, Issue Pt 19, pp. 3378-88, 2010 (Pubmed)
Catalog No. ABIN3386779
$190.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human SMAD2 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
SMAD, Mothers Against DPP Homolog 2
NCBI Accession:
NM_005901, NP_005892
Species:
Human
Synonyms:
SMAD2, smad2, Smad2
Insert length:
3000 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Bacterial Resistance:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Tone, Furuuchi, Kojima, Tykocinski, Greene, Tone: "Smad3 and NFAT cooperate to induce Foxp3 expression through its enhancer." in: Nature immunology, Vol. 9, Issue 2, pp. 194-202, 2008 (Pubmed)
Catalog No. ABIN3386827
$190.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human SPOP is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Speckle-Type POZ Protein
NCBI Accession:
NM_003563, NP_003554
Species:
Human
Synonyms:
spop, SPOP, Bm1_45730, spop-b, Spop
Insert length:
2430 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Bacterial Resistance:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Lutz, Pace, Arnold: "Rotavirus NSP1 Associates with Components of the Cullin RING Ligase Family of E3 Ubiquitin Ligases." in: Journal of virology, Vol. 90, Issue 13, pp. 6036-48, 2016 (Pubmed)
Catalog No. ABIN3386943
$190.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human TBXAS1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
thromboxane A Synthase 1 (Platelet)
NCBI Accession:
NM_001061, NP_001052
Species:
Human
Synonyms:
PTRG_00454, PTRG_06796, thas, TBXAS1, tbxas1, Tbxas1
Insert length:
1960 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Bacterial Resistance:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Meling, Zelasko, Kambalyal, Roy, Das: "Functional role of the conserved i-helix residue I346 in CYP5A1-Nanodiscs." in: Biophysical chemistry, Vol. 200-201, Issue , pp. 34-40, 2015 (Pubmed)
  • Das, Varma, Mularczyk, Meling: "Functional investigations of thromboxane synthase (CYP5A1) in lipid bilayers of nanodiscs." in: Chembiochem : a European journal of chemical biology, Vol. 15, Issue 6, pp. 892-9, 2014 (Pubmed)
  • Huang, Chu, Huang, Chen, Jiang, Zhang, Zeng: "18β-Glycyrrhetinic acid suppresses cell proliferation through inhibiting thromboxane synthase in non-small cell lung cancer." in: PLoS ONE, Vol. 9, Issue 4, pp. e93690, 2014 (Pubmed)
Catalog No. ABIN3387157
$190.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human STAT6 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Signal Transducer and Activator of Transcription 6, Interleukin-4 Induced
NCBI Accession:
NM_003153, NP_003144
Species:
Human
Synonyms:
STAT6, Stat6, LOC100859543
Insert length:
3460 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Bacterial Resistance:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • White, Martin, Abe, Marroquin, Stern, Fu: "Insulin receptor substrate-1/2 mediates IL-4-induced migration of human airway epithelial cells." in: American journal of physiology. Lung cellular and molecular physiology, Vol. 297, Issue 1, pp. L164-73, 2009 (Pubmed)
Catalog No. ABIN3387017
$190.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human ASS1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Argininosuccinate Synthase 1
NCBI Accession:
NM_054012, NP_446464
Species:
Human
Synonyms:
ASS1, ass1, Ass1
Insert length:
1500 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Bacterial Resistance:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Battisti, Valente, Albonici, Bei, Modesti, Palumbo: "Nutritional stress and arginine auxotrophy confer high sensitivity to chloroquine toxicity in mesothelioma cells." in: American journal of respiratory cell and molecular biology, Vol. 46, Issue 4, pp. 498-506, 2012 (Pubmed)
Catalog No. ABIN3377117
$190.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human CDA is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Cytidine Deaminase
NCBI Accession:
NM_001785, NP_001776
Species:
Human
Synonyms:
CDA, cda, CDD1, cdd, cdd-1, cdd-2, CNC04940, Tb09.160.1680, Cda
Insert length:
910 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Bacterial Resistance:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Sharma, Patnaik, Taggart, Kannisto, Enriquez, Gollnick, Baysal: "APOBEC3A cytidine deaminase induces RNA editing in monocytes and macrophages." in: Nature communications, Vol. 6, Issue , pp. 6881, 2015 (Pubmed)
Catalog No. ABIN3377397
$190.00
1 kit
Will be delivered in 8 to 11 Business Days
  • <
  • 1
  • ...
  • ...
  • ...
  • ...