cDNA Clones

Complementary DNA or in short cDNA is the product of reverse transcription from an RNA template. Typically, mRNA serves as template for the generation of a cDNA in which its poly-(A) tail is used as a primer site for reverse transcriptase. Subsequently, the cDNA product is amplified by PCR. Usually cDNA does not contain any introns and corresponds oftentimes to the actual coding sequence of gene. As such, cDNA is an important intermediate on the way to expressing a protein of interest. A complete cDNA library of a given organism represents its transcriptome. Derived from mRNA and including 5’ and 3’ UTRs, our cDNA collections are ideal for overexpressing a gene in the context of native regulation.
585,860 Products
Data Quality
  • 2024
  • 585860
  • 222
  • 209
  • 202
  • 150
  • 149
  • 236621
  • 194128
  • 153712
  • 506
  • 266
  • 585860
  • 397475
  • 215849
  • 154617
  • 114972
  • 323143
  • 247251
  • 9413
  • 6053
Vector Backbone
  • 62463
  • 62462
  • 62462
  • 62462
  • 61225
Fusion tag
  • 91226
  • 187387
  • 62462
  • 61225
  • 61224
Resistance Gene
  • 548938
  • 36922
Selectable Marker
  • 305725
  • 1
  • 264113
  • 247373
  • 75770
  • 803
Expression Type
  • 323196
  • 247197
  • 4215
  • 323143
  • 262717
Supplier: Log in to see

Untagged full-length cDNA clone from Human TRIB1 is ideal for over-expression of native protein for functional studies.

Protein Expression
Tribbles Homolog 1 (Drosophila) (TRIB1)
NCBI Accession:
TRIB1, trib1, Trib1
Insert length:
3240 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Soubeyrand, Martinuk, Lau, McPherson: "TRIB1 Is Regulated Post-Transcriptionally by Proteasomal and Non-Proteasomal Pathways." in: PLoS ONE, Vol. 11, Issue 3, pp. e0152346, 2016 (Pubmed)
Catalog No. ABIN3387439
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human TSG101 is ideal for over-expression of native protein for functional studies.

Protein Expression
Tumor Susceptibility Gene 101 (TSG101)
NCBI Accession:
TSG101, tsg-101, tsg101, Tsg101
Insert length:
1560 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Gray, Alsamman, Murray, Sims, Hupp: "Engineering a synthetic cell panel to identify signalling components reprogrammed by the cell growth regulator anterior gradient-2." in: Molecular bioSystems, Vol. 10, Issue 6, pp. 1409-25, 2014 (Pubmed)
Catalog No. ABIN3387479
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human SPOP is ideal for over-expression of native protein for functional studies.

Protein Expression
Speckle-Type POZ Protein (SPOP)
NCBI Accession:
spop, SPOP, Bm1_45730, spop-b, Spop
Insert length:
2430 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Lutz, Pace, Arnold: "Rotavirus NSP1 Associates with Components of the Cullin RING Ligase Family of E3 Ubiquitin Ligases." in: Journal of virology, Vol. 90, Issue 13, pp. 6036-48, 2016 (Pubmed)
Catalog No. ABIN3386943
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human VAPB is ideal for over-expression of native protein for functional studies.

Protein Expression
VAMP (Vesicle-Associated Membrane Protein)-Associated Protein B and C (VAPB)
NCBI Accession:
Tsp_07972, VAPB, LOC788595, LOC100350714, Vapb
Insert length:
2440 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Aliaga, Lai, Yu, Chub, Shim, Sun, Xie, Yang, Lin, ODonovan, Cai: "Amyotrophic lateral sclerosis-related VAPB P56S mutation differentially affects the function and survival of corticospinal and spinal motor neurons." in: Human molecular genetics, Vol. 22, Issue 21, pp. 4293-305, 2013 (Pubmed)
  • De Vos, Mórotz, Stoica, Tudor, Lau, Ackerley, Warley, Shaw, Miller: "VAPB interacts with the mitochondrial protein PTPIP51 to regulate calcium homeostasis." in: Human molecular genetics, Vol. 21, Issue 6, pp. 1299-311, 2012 (Pubmed)
Catalog No. ABIN3387670
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human PEPD is ideal for over-expression of native protein for functional studies.

Protein Expression
Peptidase D (PEPD)
NCBI Accession:
pepd, pepD, PEPD, Pepd
Insert length:
1910 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Yang, Li, Ding, Choi, Kazim, Zhang: "Prolidase directly binds and activates epidermal growth factor receptor and stimulates downstream signaling." in: The Journal of biological chemistry, Vol. 288, Issue 4, pp. 2365-75, 2013 (Pubmed)
Catalog No. ABIN3385756
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human RNF139 is ideal for over-expression of native protein for functional studies.

Protein Expression
Ring Finger Protein 139 (RNF139)
NCBI Accession:
RNF139, Rnf139
Insert length:
2500 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Lin, Lan, Chau: "TRC8 suppresses tumorigenesis through targeting heme oxygenase-1 for ubiquitination and degradation." in: Oncogene, Vol. 32, Issue 18, pp. 2325-34, 2013 (Pubmed)
Catalog No. ABIN3386406
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human PINK1 is ideal for over-expression of native protein for functional studies.

Protein Expression
PTEN Induced Putative Kinase 1 (PINK1)
NCBI Accession:
Pink1, PINK1, pink1
Insert length:
2710 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Aerts, Craessaerts, De Strooper, Morais: "In Vitro Comparison of the Activity Requirements and Substrate Specificity of Human and Triboleum castaneum PINK1 Orthologues." in: PLoS ONE, Vol. 11, Issue 1, pp. e0146083, 2016 (Pubmed)
  • Aerts, Craessaerts, De Strooper, Morais: "PINK1 kinase catalytic activity is regulated by phosphorylation on serines 228 and 402." in: The Journal of biological chemistry, Vol. 290, Issue 5, pp. 2798-811, 2015 (Pubmed)
  • Gómez-Sánchez, Gegg, Bravo-San Pedro, Niso-Santano, Alvarez-Erviti, Pizarro-Estrella, Gutiérrez-Martín, Alvarez-Barrientos, Fuentes, González-Polo, Schapira: "Mitochondrial impairment increases FL-PINK1 levels by calcium-dependent gene expression." in: Neurobiology of disease, Vol. 62, Issue , pp. 426-40, 2013 (Pubmed)
  • Zhou, Huang, Shao, May, Prou, Perier, Dauer, Schon, Przedborski: "The kinase domain of mitochondrial PINK1 faces the cytoplasm." in: Proceedings of the National Academy of Sciences of the United States of America, Vol. 105, Issue 33, pp. 12022-7, 2008 (Pubmed)
  • Sim, Lio, Mok, Masters, Hill, Culvenor, Cheng: "C-terminal truncation and Parkinson's disease-associated mutations down-regulate the protein serine/threonine kinase activity of PTEN-induced kinase-1." in: Human molecular genetics, Vol. 15, Issue 21, pp. 3251-62, 2006 (Pubmed)
  • Petit, Kawarai, Paitel, Sanjo, Maj, Scheid, Chen, Gu, Hasegawa, Salehi-Rad, Wang, Rogaeva, Fraser, Robinson, St George-Hyslop, Tandon: "Wild-type PINK1 prevents basal and induced neuronal apoptosis, a protective effect abrogated by Parkinson disease-related mutations." in: The Journal of biological chemistry, Vol. 280, Issue 40, pp. 34025-32, 2005 (Pubmed)
  • Show more References
Catalog No. ABIN3385829
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human RPE65 is ideal for over-expression of native protein for functional studies.

Protein Expression
Retinal Pigment Epithelium-Specific Protein 65kDa (RPE65)
NCBI Accession:
rpe65c, LOC100219959, LOC100352270, Rpe65, RPE65
Insert length:
2780 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Bavik, Henry, Zhang, Mitts, McGinn, Budzynski, Pashko, Lieu, Zhong, Blumberg, Kuksa, Orme, Scott, Fawzi, Kubota: "Visual Cycle Modulation as an Approach toward Preservation of Retinal Integrity." in: PLoS ONE, Vol. 10, Issue 5, pp. e0124940, 2015 (Pubmed)
Catalog No. ABIN3386437
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human PGRMC1 is ideal for over-expression of native protein for functional studies.

Protein Expression
Progesterone Receptor Membrane Component 1 (PGRMC1)
NCBI Accession:
pgrmc1, PGRMC1, Pgrmc1
Insert length:
1800 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Thomas, Pang, Dong et al.: "Enhancement of cell surface expression and receptor functions of membrane progestin receptor α (mPRα) by progesterone receptor membrane component 1 (PGRMC1): evidence for a role of PGRMC1 as an ..." in: Endocrinology, Vol. 155, Issue 3, pp. 1107-19, 2014 (Pubmed)
Catalog No. ABIN3385781
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human POT1 is ideal for over-expression of native protein for functional studies.

Protein Expression
Protection of Telomeres 1 Homolog (S. Pombe) (POT1)
NCBI Accession:
POT1, Pot1, Pot1a
Insert length:
2930 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Robles-Espinoza, Harland, Ramsay, Aoude, Quesada, Ding, Pooley, Pritchard, Tiffen, Petljak, Palmer, Symmons, Johansson, Stark, Gartside, Snowden, Montgomery, Martin, Liu, Choi, Makowski, Brown et al.: "POT1 loss-of-function variants predispose to familial melanoma. ..." in: Nature genetics, Vol. 46, Issue 5, pp. 478-81, 2014 (Pubmed)
Catalog No. ABIN3385950
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human NDUFV1 is ideal for over-expression of native protein for functional studies.

Protein Expression
NADH Dehydrogenase (Ubiquinone) Flavoprotein 1, 51kDa (NDUFV1)
NCBI Accession:
Ndufv1, NDUFV1, ndufv1
Insert length:
1570 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Jacquemin, Margiotta, Kasahara, Bassoy, Walch, Thiery, Lieberman, Martinvalet: "Granzyme B-induced mitochondrial ROS are required for apoptosis." in: Cell death and differentiation, Vol. 22, Issue 5, pp. 862-74, 2015 (Pubmed)
Catalog No. ABIN3385404
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human PPM1K is ideal for over-expression of native protein for functional studies.

Protein Expression
Protein Phosphatase, Mg2+/Mn2+ Dependent, 1K (PPM1K)
NCBI Accession:
Ppm1k, ppm1k, PPM1K
Insert length:
2250 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Marion, Urs, Peterson, Sotnikova, Beaulieu, Gainetdinov, Caron: "Dopamine D2 receptor relies upon PPM/PP2C protein phosphatases to dephosphorylate huntingtin protein." in: The Journal of biological chemistry, Vol. 289, Issue 17, pp. 11715-24, 2014 (Pubmed)
Catalog No. ABIN3385980
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human NFYA is ideal for over-expression of native protein for functional studies.

Protein Expression
Nuclear Transcription Factor Y, alpha (NFYA)
NCBI Accession:
nfya, NFYA, Nfya
Insert length:
3570 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Morachis, Murawsky, Emerson: "Regulation of the p53 transcriptional response by structurally diverse core promoters." in: Genes & development, Vol. 24, Issue 2, pp. 135-47, 2010 (Pubmed)
  • Chia, Leung, Krushel, Alajez, Lo, Busson, Klamut, Bastianutto, Liu: "Nuclear factor-Y and Epstein Barr virus in nasopharyngeal cancer." in: Clinical cancer research : an official journal of the American Association for Cancer Research, Vol. 14, Issue 4, pp. 984-94, 2008 (Pubmed)
Catalog No. ABIN3385438
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human PPT1 is ideal for over-expression of native protein for functional studies.

Protein Expression
Palmitoyl-Protein Thioesterase 1 (PPT1)
NCBI Accession:
MGYG_00692, PPT1, Ppt1, ppt-1, RGD1560700
Insert length:
2610 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Mamo, Jules, Dumaresq-Doiron, Costantino, Lefrancois: "The role of ceroid lipofuscinosis neuronal protein 5 (CLN5) in endosomal sorting." in: Molecular and cellular biology, Vol. 32, Issue 10, pp. 1855-66, 2012 (Pubmed)
Catalog No. ABIN3386017
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human NMT1 is ideal for over-expression of native protein for functional studies.

Protein Expression
N-Myristoyltransferase 1 (NMT1)
NCBI Accession:
nmt2, nmt1, SPBC2G2.11, NMT1, Nmt1, nmt1a
Insert length:
1870 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Kumar, Sharma: "An improved method and cost effective strategy for soluble expression and purification of human N-myristoyltransferase 1 in E. coli." in: Molecular and cellular biochemistry, Vol. 392, Issue 1-2, pp. 175-86, 2014 (Pubmed)
Catalog No. ABIN3385469
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human PRMT5 is ideal for over-expression of native protein for functional studies.

Protein Expression
Protein Arginine Methyltransferase 5 (PRMT5)
NCBI Accession:
PRMT5, prmt5, Prmt5, Hrmt1l5, prmt-5
Insert length:
2500 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Yang, Wang, Ren, Jin, Wang, Sun, Diao, Wang, Mi: "Proliferative role of TRAF4 in breast cancer by upregulating PRMT5 nuclear expression." in: Tumour biology, Vol. 36, Issue 8, pp. 5901-11, 2015 (Pubmed)
  • Ratovitski, Arbez, Stewart, Chighladze, Ross: "PRMT5- mediated symmetric arginine dimethylation is attenuated by mutant huntingtin and is impaired in Huntington's disease (HD)." in: Cell cycle (Georgetown, Tex.), Vol. 14, Issue 11, pp. 1716-29, 2015 (Pubmed)
Catalog No. ABIN3386054
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human MMP14 is ideal for over-expression of native protein for functional studies.

Protein Expression
Matrix Metallopeptidase 14 (Membrane-inserted) (MMP14)
NCBI Accession:
mmp14, MMP14, Mmp14
Insert length:
3500 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, SP6 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Stratman, Saunders, Sacharidou, Koh, Fisher, Zawieja, Davis, Davis: "Endothelial cell lumen and vascular guidance tunnel formation requires MT1-MMP-dependent proteolysis in 3-dimensional collagen matrices." in: Blood, Vol. 114, Issue 2, pp. 237-47, 2009 (Pubmed)
  • Nacu, Luzina, Highsmith, Lockatell, Pochetuhen, Cooper, Gillmeister, Todd, Atamas: "Macrophages produce TGF-beta-induced (beta-ig-h3) following ingestion of apoptotic cells and regulate MMP14 levels and collagen turnover in fibroblasts." in: Journal of immunology (Baltimore, Md. : 1950), Vol. 180, Issue 7, pp. 5036-44, 2008 (Pubmed)
Catalog No. ABIN3393641
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human PI4K2A is ideal for over-expression of native protein for functional studies.

Protein Expression
Phosphatidylinositol 4-Kinase Type 2 alpha (PI4K2A)
NCBI Accession:
PI4K2A, pi4k2a, Pi4k2a
Insert length:
4000 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, SP6 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Moorhead, Jung, Smirnov, Kaufer, Scidmore: "Multiple host proteins that function in phosphatidylinositol-4-phosphate metabolism are recruited to the chlamydial inclusion." in: Infection and immunity, Vol. 78, Issue 5, pp. 1990-2007, 2010 (Pubmed)
Catalog No. ABIN3393695
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human KPNA2 is ideal for over-expression of native protein for functional studies.

Protein Expression
Karyopherin alpha 2 (RAG Cohort 1, Importin alpha 1) (KPNA2)
NCBI Accession:
EDI_246290, EDI_335040, ima2, kpna2, Kpna2, KPNA2, Kpna7
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter
Transient, Stable
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Wang, Zhao, Bi, Sun, Liu, Liu: "Tyrosine 132 phosphorylation of influenza A virus M1 protein is crucial for virus replication by controlling the nuclear import of M1." in: Journal of virology, Vol. 87, Issue 11, pp. 6182-91, 2013 (Pubmed)
Catalog No. ABIN3319028
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human LRG1 is ideal for over-expression of native protein for functional studies.

Protein Expression
Leucine-Rich alpha-2 Glycoprotein 1 (LRG1)
NCBI Accession:
si:dkey-90m5.4, LRG1, lrg1, Lrg1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter
Transient, Stable
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Guergova-Kuras, Kurucz, Hempel, Tardieu, Kádas, Malderez-Bloes, Jullien, Kieffer, Hincapie, Guttman, Csánky, Dezso, Karger, Takács: "Discovery of lung cancer biomarkers by profiling the plasma proteome with monoclonal antibody libraries." in: Molecular & cellular proteomics : MCP, Vol. 10, Issue 12, pp. M111.010298, 2011 (Pubmed)
Catalog No. ABIN3319052
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
  • <
  • 1
  • ...
  • ...
  • ...
  • ...
  • ...