You are viewing an incomplete version of our website. Please click to reload the website as full version.

cDNA Clones

Complementary DNA or in short cDNA is the product of reverse transcription from an RNA template. Typically, mRNA serves as template for the generation of a cDNA in which its poly-(A) tail is used as a primer site for reverse transcriptase. Subsequently, the cDNA product is amplified by PCR. Usually cDNA does not contain any introns and corresponds oftentimes to the actual coding sequence of gene. As such, cDNA is an important intermediate on the way to expressing a protein of interest. A complete cDNA library of a given organism represents its transcriptome. Derived from mRNA and including 5’ and 3’ UTRs, our cDNA collections are ideal for overexpressing a gene in the context of native regulation.
785,870 Products
Data Quality
  • 2024
Type
  • 785870
    Plasmid
Gene
  • 229
  • 226
  • 209
  • 165
  • 163
Species
  • 284091
  • 247454
  • 167151
  • 27699
  • 21907
Insert
  • 785870
    cDNA
  • 365420
  • 249906
  • 39144
  • 2
Vector
  • 442109
  • 247253
  • 87095
  • 9413
Vector Backbone
  • 62464
  • 62463
  • 62463
  • 62463
  • 61225
Fusion tag
  • 291232
  • 187390
  • 62463
  • 61225
  • 61224
Bacterial Resistance
  • 563560
  • 199142
  • 23502
Selectable Marker
  • 335065
  • 14372
  • 58
  • 1
Promoter
  • 264115
  • 247375
  • 182025
  • 9106
  • 803
Expression Type
  • 438742
  • 247445
  • 4205
  • 3174
  • 10
Application
  • 462725
  • 442109
Supplier: Log in to see
ISO 9001:2008

Full length Clone DNA of Homo sapiens protease, serine, 8.

Type:
cDNA
Application:
Cloning
Gene:
Protease, serine, 8
NCBI Accession:
NM_002773
Species:
Human
Synonyms:
Prss8, PRSS8
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Bacterial Resistance:
Ampicillin
Sequencing Primer:
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Publications
  • Zhang, Jia, Shi, Ge, Duan, Yang: "PRSS8 is Downregulated and Suppresses Tumour Growth and Metastases in Hepatocellular Carcinoma." in: Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, Vol. 40, Issue 3-4, pp. 757-769, 2016 (Pubmed)
Catalog No. ABIN3563885
$137.50
1 vial
Will be delivered in 7 to 8 Business Days
Supplier: Log in to see
ISO 9001:2008

Full length Clone DNA of Homo sapiens basigin (Ok blood group) (BSG), transcript variant 2.

Type:
cDNA
Application:
Cloning
Gene:
Basigin (Ok Blood Group)
NCBI Accession:
NM_198589
Species:
Human
Synonyms:
BSG, Bsg
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Bacterial Resistance:
Ampicillin
Sequencing Primer:
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Publications
  • Rathore, Dass, Kandari, Kaur, Gupta, Sharma: "Basigin interacts with Plasmodium vivax tryptophan-rich antigen PvTRAg38 as a second erythrocyte receptor to promote parasite growth." in: The Journal of biological chemistry, Vol. , Issue , pp. , 2016 (Pubmed)
Catalog No. ABIN3886420
$104.50
1 vial
Will be delivered in 7 to 8 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Wnt11 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Wingless-Type MMTV Integration Site Family, Member 11
NCBI Accession:
NM_001285795, NP_001272724
Species:
Mouse (Murine)
Synonyms:
WNT11, WNT-11, wnt11, LOC100229189, Wnt11
Insert length:
558 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Bacterial Resistance:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3373081
$210.00
1 kit
Will be delivered in 16 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Bad is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
BCL2-Associated Agonist of Cell Death
NCBI Accession:
NM_001285453, NP_001272382
Species:
Mouse (Murine)
Synonyms:
badb, BAD, Bad
Insert length:
489 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Bacterial Resistance:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3299717
$210.00
1 kit
Will be delivered in 16 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Nanog is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Nanog Homeobox
NCBI Accession:
NM_001289830, NP_001276759
Species:
Mouse (Murine)
Synonyms:
Nanog, NANOG
Insert length:
843 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Bacterial Resistance:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3331767
$280.00
1 kit
Will be delivered in 16 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Nanog is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Nanog Homeobox
NCBI Accession:
NM_001289831, NP_001276760
Species:
Mouse (Murine)
Synonyms:
Nanog, NANOG
Insert length:
843 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Bacterial Resistance:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3331768
$280.00
1 kit
Will be delivered in 16 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Otx2 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Orthodenticle Homeobox 2
NCBI Accession:
NM_001286482, NP_001273411
Species:
Mouse (Murine)
Synonyms:
OTX2, Otx2, otx2-a, otx2
Insert length:
870 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Bacterial Resistance:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3363145
$290.00
1 kit
Will be delivered in 16 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Otx2 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Orthodenticle Homeobox 2
NCBI Accession:
NM_001286483, NP_001273412
Species:
Mouse (Murine)
Synonyms:
OTX2, Otx2, otx2-a, otx2
Insert length:
870 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Bacterial Resistance:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3363146
$290.00
1 kit
Will be delivered in 16 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Wnt11 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Wingless-Type MMTV Integration Site Family, Member 11
NCBI Accession:
NM_001285794, NP_001272723
Species:
Mouse (Murine)
Synonyms:
WNT11, WNT-11, wnt11, LOC100229189, Wnt11
Insert length:
870 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Bacterial Resistance:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3373082
$290.00
1 kit
Will be delivered in 16 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Otx2 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Orthodenticle Homeobox 2
NCBI Accession:
NM_001286481, NP_001273410
Species:
Mouse (Murine)
Synonyms:
OTX2, Otx2, otx2-a, otx2
Insert length:
894 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Bacterial Resistance:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3363147
$300.00
1 kit
Will be delivered in 16 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Nanog is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Nanog Homeobox
NCBI Accession:
NM_001289828, NP_001276757
Species:
Mouse (Murine)
Synonyms:
Nanog, NANOG
Insert length:
915 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Bacterial Resistance:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3331769
$300.00
1 kit
Will be delivered in 16 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Olfr631 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Olfactory Receptor 631
NCBI Accession:
NM_001271020, NP_001257949
Species:
Mouse (Murine)
Synonyms:
Olfr631, Olr631
Insert length:
960 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Bacterial Resistance:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3334158
$320.00
1 kit
Will be delivered in 16 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Wnt11 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Wingless-Type MMTV Integration Site Family, Member 11
NCBI Accession:
NM_001285792, NP_001272721
Species:
Mouse (Murine)
Synonyms:
WNT11, WNT-11, wnt11, LOC100229189, Wnt11
Insert length:
1065 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Bacterial Resistance:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3373083
$350.00
1 kit
Will be delivered in 16 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Oprl1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Opiate Receptor-Like 1
NCBI Accession:
NM_001252565, NP_001239494
Species:
Mouse (Murine)
Synonyms:
LOC100051762, OPRL1, oprl1, LOC100335303, Oprl1
Insert length:
1104 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Bacterial Resistance:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3362986
$360.00
1 kit
Will be delivered in 16 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Trpc6 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Transient Receptor Potential Cation Channel, Subfamily C, Member 6
NCBI Accession:
NM_001282087, NP_001269016
Species:
Mouse (Murine)
Synonyms:
TRPC6, trpc6, Trpc6, trpc6a
Insert length:
1221 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Bacterial Resistance:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3337885
$400.00
1 kit
Will be delivered in 16 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Otx2 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Orthodenticle Homeobox 2
NCBI Accession:
NP_659090
Species:
Mouse (Murine)
Synonyms:
OTX2, Otx2, otx2-a, otx2
Insert length:
870 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Bacterial Resistance:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3363144
$410.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Sall4 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Sal-Like 4 (Drosophila)
NCBI Accession:
NM_201396, NP_958798
Species:
Mouse (Murine)
Synonyms:
SALL4, sall4, LOC100230247, Sall4
Insert length:
837 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Bacterial Resistance:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3369016
$410.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Sp5 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Sp5 Transcription Factor
NCBI Accession:
NM_022435, NP_071880
Species:
Mouse (Murine)
Synonyms:
Sp5, sp5, SP5, CpipJ_CPIJ003609
Insert length:
1197 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Bacterial Resistance:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3371692
$410.00
1 kit
Will be delivered in 31 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Wnt3a is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Wingless-Type MMTV Integration Site Family, Member 3A
NCBI Accession:
NM_009522, NP_033548
Species:
Mouse (Murine)
Synonyms:
WNT3A, Wnt3a, wnt3a
Insert length:
1059 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Bacterial Resistance:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Parr, Mirzaei, Christian, Sastre: "Activation of the Wnt/β-catenin pathway represses the transcription of the β-amyloid precursor protein cleaving enzyme (BACE1) via binding of T-cell factor-4 to BACE1 promoter." in: FASEB journal : official publication of the Federation of American Societies for Experimental Biology, Vol. 29, Issue 2, pp. 623-35, 2015 (Pubmed)
Catalog No. ABIN3376391
$410.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Olfr323 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Olfactory Receptor 323
NCBI Accession:
NM_146376, NP_666488
Species:
Mouse (Murine)
Synonyms:
Olfr323, Olr323
Insert length:
972 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Bacterial Resistance:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3333908
$410.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Olfr554 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Olfactory Receptor 554
NCBI Accession:
NM_146325, NP_666437
Species:
Mouse (Murine)
Synonyms:
Olfr554, Olr554
Insert length:
954 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Bacterial Resistance:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3334091
$410.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Olfr56 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Olfactory Receptor 56
NCBI Accession:
NM_010999, NP_035129
Species:
Mouse (Murine)
Synonyms:
Olfr56, Olr56, Or-56
Insert length:
852 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Bacterial Resistance:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3334097
$410.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Olfr545 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Olfactory Receptor 545
NCBI Accession:
NM_146840, NP_667051
Species:
Mouse (Murine)
Synonyms:
Olfr545, Olr545
Insert length:
951 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Bacterial Resistance:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3334083
$410.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Olfr600 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Olfactory Receptor 600
NCBI Accession:
NM_147046, NP_667257
Species:
Mouse (Murine)
Synonyms:
OLFR600, Olfr600
Insert length:
945 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Bacterial Resistance:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3334131
$410.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Olfr611 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Olfactory Receptor 611
NCBI Accession:
NM_146727, NP_666938
Species:
Mouse (Murine)
Synonyms:
Olr611, Olfr611
Insert length:
972 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Bacterial Resistance:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3334140
$410.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Olfr628 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Olfactory Receptor 628
NCBI Accession:
NM_147097, NP_667308
Species:
Mouse (Murine)
Synonyms:
Olfr628
Insert length:
951 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Bacterial Resistance:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3334153
$410.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Olfr631 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Olfactory Receptor 631
NCBI Accession:
NM_146959, NP_667170
Species:
Mouse (Murine)
Synonyms:
Olfr631, Olr631
Insert length:
960 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Bacterial Resistance:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3334157
$410.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Olfr632 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Olfactory Receptor 632
NCBI Accession:
NM_147119, NP_667330
Species:
Mouse (Murine)
Synonyms:
Olfr632
Insert length:
954 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Bacterial Resistance:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3334159
$410.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Olfr653 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Olfactory Receptor 653
NCBI Accession:
NM_147074, NP_667285
Species:
Mouse (Murine)
Synonyms:
Olfr653, Olr653, OLFR653
Insert length:
954 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Bacterial Resistance:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3334177
$410.00
1 kit
Will be delivered in 21 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Olfr661 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Olfactory Receptor 661
NCBI Accession:
NM_146748, NP_666959
Species:
Mouse (Murine)
Synonyms:
Olfr661, Olr661
Insert length:
960 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Bacterial Resistance:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3334185
$410.00
1 kit
Will be delivered in 21 Business Days
  • <
  • 1
  • ...
  • ...
  • ...
  • ...