cDNA Clones

Complementary DNA or in short cDNA is the product of reverse transcription from an RNA template. Typically, mRNA serves as template for the generation of a cDNA in which its poly-(A) tail is used as a primer site for reverse transcriptase. Subsequently, the cDNA product is amplified by PCR. Usually cDNA does not contain any introns and corresponds oftentimes to the actual coding sequence of gene. As such, cDNA is an important intermediate on the way to expressing a protein of interest. A complete cDNA library of a given organism represents its transcriptome. Derived from mRNA and including 5’ and 3’ UTRs, our cDNA collections are ideal for overexpressing a gene in the context of native regulation.
585,859 Products
Data Quality
  • 2024
Type
  • 585859
    Plasmid
Gene
  • 222
  • 209
  • 202
  • 150
  • 149
Species
  • 236621
  • 194127
  • 153712
  • 506
  • 266
Insert
  • 585859
    cDNA
  • 412142
  • 215850
  • 154617
  • 114972
Vector
  • 323141
  • 247251
  • 9413
  • 6054
Vector Backbone
  • 62463
  • 62462
  • 62462
  • 62461
  • 61225
Fusion tag
  • 91226
  • 187387
  • 62461
  • 61225
  • 61224
Resistance Gene
  • 548936
  • 36923
Selectable Marker
  • 305723
  • 1
Promoter
  • 264113
  • 247372
  • 75769
  • 803
Expression Type
  • 323195
  • 247196
  • 4215
Application
  • 323141
  • 262718
Supplier: Log in to see

Untagged full-length cDNA clone from Human SPHK1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Sphingosine Kinase 1 (SPHK1)
NCBI Accession:
NM_021972,NP_068807
Species:
Human
Synonyms:
Sk1, SPHK1, sphk1, LOC100357790, Sphk1
Insert length:
1900 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, Stable
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Jiang, Smith, Li, Rao, Liu, Donahue, Wang, Turner: "Sphingosine kinase 1 overexpression stimulates intestinal epithelial cell proliferation through increased c-Myc translation." in: American journal of physiology. Cell physiology, Vol. 304, Issue 12, pp. C1187-97, 2013 (Pubmed)
  • Antoon, White, Driver, Burow, Beckman: "Sphingosine kinase isoforms as a therapeutic target in endocrine therapy resistant luminal and basal-A breast cancer." in: Experimental biology and medicine (Maywood, N.J.), Vol. 237, Issue 7, pp. 832-44, 2012 (Pubmed)
Catalog No. ABIN3318318
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human SOX9 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
SRY (Sex Determining Region Y)-Box 9 (SOX9)
NCBI Accession:
NM_000346,NP_000337
Species:
Human
Synonyms:
SOX9, LOC100227849, SOX10, Sox9
Insert length:
2600 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, Stable
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Luanpitpong, Li, Manke, Brundage, Ellis, McLaughlin, Angsutararux, Chanthra, Voronkova, Chen, Wang, Chanvorachote, Pei, Issaragrisil, Rojanasakul: "SLUG is required for SOX9 stabilization and functions to promote cancer stem cells and metastasis in human lung carcinoma." in: Oncogene, Vol. 35, Issue 22, pp. 2824-33, 2016 (Pubmed)
  • Shakhova, Cheng, Mishra, Zingg, Schaefer, Debbache, Häusel, Matter, Guo, Davis, Meltzer, Mihic-Probst, Moch, Wegner, Merlino, Levesque, Dummer, Santoro, Cinelli, Sommer: "Antagonistic cross-regulation between Sox9 and Sox10 controls an anti-tumorigenic program in melanoma." in: PLoS genetics, Vol. 11, Issue 1, pp. e1004877, 2015 (Pubmed)
  • Ikhapoh, Pelham, Agrawal: "Sry-type HMG box 18 contributes to the differentiation of bone marrow-derived mesenchymal stem cells to endothelial cells." in: Differentiation; research in biological diversity, Vol. 89, Issue 3-4, pp. 87-96, 2015 (Pubmed)
  • Matsushima, Kuroki, Kitasato, Adachi, Tanaka, Hirabaru, Hirayama, Kuroshima, Hidaka, Soyama, Takatsuki, Kinoshita, Sano, Nishida, Eguchi: "Sox9 expression in carcinogenesis and its clinical significance in intrahepatic cholangiocarcinoma." in: Digestive and liver disease : official journal of the Italian Society of Gastroenterology and the Italian Association for the Study of the Liver, Vol. 47, Issue 12, pp. 1067-75, 2015 (Pubmed)
  • Bobick, Alexander, Tuan: "High efficiency transfection of embryonic limb mesenchyme with plasmid DNA using square wave pulse electroporation and sucrose buffer." in: BioTechniques, Vol. 56, Issue 2, pp. 85-9, 2014 (Pubmed)
  • Needham, Shah, Dahlin, Kinard, Lam, Watson, Lu, Kasper, Mikos: "Osteochondral tissue regeneration through polymeric delivery of DNA encoding for the SOX trio and RUNX2." in: Acta biomaterialia, Vol. 10, Issue 10, pp. 4103-12, 2014 (Pubmed)
  • Mata-Rocha, Hernández-Sánchez, Guarneros, de la Chesnaye, Sánchez-Tusié, Treviño, Felix, Oviedo: "The transcription factors Sox5 and Sox9 regulate Catsper1 gene expression." in: FEBS letters, Vol. 588, Issue 18, pp. 3352-60, 2014 (Pubmed)
  • Show more References
Catalog No. ABIN3319363
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human KLF5 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Kruppel-Like Factor 5 (Intestinal) (KLF5)
NCBI Accession:
NM_001730,NP_001721
Species:
Human
Synonyms:
KLF5, LOC100231095, klf5, Klf5
Insert length:
1700 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, Stable
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Yang, Nakagawa, Tetreault, Billig, Victor, Goyal, Sepulveda, Katz: "Loss of transcription factor KLF5 in the context of p53 ablation drives invasive progression of human squamous cell cancer." in: Cancer research, Vol. 71, Issue 20, pp. 6475-84, 2011 (Pubmed)
Catalog No. ABIN3317771
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human UCP2 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Uncoupling Protein 2 (Mitochondrial, Proton Carrier) (UCP2)
NCBI Accession:
NM_003355,NP_003346
Species:
Human
Synonyms:
PTRG_09289, UCP2, LOC100282746, ucp2, TEgg068n20.1, LOC100534553, Ucp2
Insert length:
1660 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, Stable
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Fiorini, Cordani, Gotte, Picone, Donadelli: "Onconase induces autophagy sensitizing pancreatic cancer cells to gemcitabine and activates Akt/mTOR pathway in a ROS-dependent manner." in: Biochimica et biophysica acta, Vol. 1853, Issue 3, pp. 549-60, 2015 (Pubmed)
Catalog No. ABIN3318600
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human EFEMP2 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Fibulin 4 (FBLN4)
NCBI Accession:
NM_016938,NP_058634
Species:
Human
Synonyms:
Efemp2, efemp2b, fbln4, EFEMP2
Insert length:
2000 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • McLaughlin, Chen, Horiguchi, Starcher, Stanton, Broekelmann, Marmorstein, McKay, Mecham, Nakamura, Marmorstein: "Targeted disruption of fibulin-4 abolishes elastogenesis and causes perinatal lethality in mice." in: Molecular and cellular biology, Vol. 26, Issue 5, pp. 1700-9, 2006 (Pubmed)
Catalog No. ABIN3377844
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human AMFR is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Autocrine Motility Factor Receptor (AMFR)
NCBI Accession:
NM_001144,NP_001135
Species:
Human
Synonyms:
AMFR, amfr, AaeL_AAEL005881, CpipJ_CPIJ016043, Smp_150210.2, Smp_047420, Amfr
Insert length:
3500 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Lin, Lan, Chau: "TRC8 suppresses tumorigenesis through targeting heme oxygenase-1 for ubiquitination and degradation." in: Oncogene, Vol. 32, Issue 18, pp. 2325-34, 2013 (Pubmed)
Catalog No. ABIN3377002
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human EXOC2 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Exocyst Complex Component 2 (EXOC2)
NCBI Accession:
NM_018303,NP_060773
Species:
Human
Synonyms:
sec5, EXOC2, LOC100226726, Exoc2, SEC5A, sec-5
Insert length:
4700 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Simicek, Lievens, Laga, Guzenko, Aushev, Kalev, Baietti, Strelkov, Gevaert, Tavernier, Sablina: "The deubiquitylase USP33 discriminates between RALB functions in autophagy and innate immune response." in: Nature cell biology, Vol. 15, Issue 10, pp. 1220-30, 2013 (Pubmed)
Catalog No. ABIN3377943
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human ACSF2 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Acyl-CoA Synthetase Family Member 2 (ACSF2)
NCBI Accession:
NM_025149,NP_079425
Species:
Human
Synonyms:
ACSF2, Acsf2, acsf2
Insert length:
4000 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Watkins, Maiguel, Jia, Pevsner: "Evidence for 26 distinct acyl-coenzyme A synthetase genes in the human genome." in: Journal of lipid research, Vol. 48, Issue 12, pp. 2736-50, 2007 (Pubmed)
Catalog No. ABIN3376894
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human DFFB is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
DNA Fragmentation Factor, 40kDa, beta Polypeptide (Caspase-Activated DNase) (DFFB)
NCBI Accession:
NM_004402,NP_004393
Species:
Human
Synonyms:
DFFB, LOC100223514, Dffb
Insert length:
3340 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Yoon, Park, Han, Kang, Kim, Lee, Park, Shin, Kim, Yun, Chwae: "Caspase-dependent cell death-associated release of nucleosome and damage-associated molecular patterns." in: Cell death & disease, Vol. 5, Issue , pp. e1494, 2014 (Pubmed)
Catalog No. ABIN3377730
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human FES is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Feline Sarcoma Oncogene (FES)
NCBI Accession:
NM_002005,NP_001996
Species:
Human
Synonyms:
FES, fes, Fes
Insert length:
3000 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Ye, Kantonen, Henkels, Gomez-Cambronero: "A new signaling pathway (JAK-Fes-phospholipase D) that is enhanced in highly proliferative breast cancer cells." in: The Journal of biological chemistry, Vol. 288, Issue 14, pp. 9881-91, 2013 (Pubmed)
  • Loriaux, Levine, Tyner, Fröhling, Scholl, Stoffregen, Wernig, Erickson, Eide, Berger, Bernard, Griffin, Stone, Lee, Meyerson, Heinrich, Deininger, Gilliland, Druker: "High-throughput sequence analysis of the tyrosine kinome in acute myeloid leukemia." in: Blood, Vol. 111, Issue 9, pp. 4788-96, 2008 (Pubmed)
Catalog No. ABIN3378040
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human CYP1A1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Cytochrome P450, Family 1, Subfamily A, Polypeptide 1 (CYP1A1)
NCBI Accession:
NM_000499,NP_000490
Species:
Human
Synonyms:
CYP1A1, CYPIA1, CpipJ_CPIJ010542, cyp1a1, Cyp1a1, LOC100328613
Insert length:
2310 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Kekatpure, Dannenberg, Subbaramaiah: "HDAC6 modulates Hsp90 chaperone activity and regulates activation of aryl hydrocarbon receptor signaling." in: The Journal of biological chemistry, Vol. 284, Issue 12, pp. 7436-45, 2009 (Pubmed)
Catalog No. ABIN3377645
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human BCL2L1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
BCL2-Like 1 (BCL2L1)
NCBI Accession:
NM_138578,NP_612815
Species:
Human
Synonyms:
bcl2l1, BCL2L1, LOC100224900, Tg(BCL2L1)2Cbt, Bcl2l1
Insert length:
2380 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Fouqué, Lepvrier, Debure, Gouriou, Malleter, Delcroix, Ovize, Ducret, Li, Hammadi, Vacher, Legembre: "The apoptotic members CD95, BclxL, and Bcl-2 cooperate to promote cell migration by inducing Ca(2+) flux from the endoplasmic reticulum to mitochondria." in: Cell death and differentiation, Vol. 23, Issue 10, pp. 1702-16, 2016 (Pubmed)
Catalog No. ABIN3382739
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human GABRA1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
gamma-aminobutyric Acid (GABA) A Receptor, alpha 1 (GABRA1)
NCBI Accession:
NM_000806,NP_000797
Species:
Human
Synonyms:
GABRA1, Gabra1, gabra1
Insert length:
2290 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Ariño, Höftberger, Gresa-Arribas, Martínez-Hernández, Armangue, Kruer, Arpa, Domingo, Rojc, Bataller, Saiz, Dalmau, Graus: "Paraneoplastic Neurological Syndromes and Glutamic Acid Decarboxylase Antibodies." in: JAMA neurology, Vol. 72, Issue 8, pp. 874-81, 2015 (Pubmed)
  • Hendriks, van Kleef, van den Berg, Westerink: "Multiple novel modes of action involved in the in vitro neurotoxic effects of tetrabromobisphenol-A." in: Toxicological sciences : an official journal of the Society of Toxicology, Vol. 128, Issue 1, pp. 235-46, 2012 (Pubmed)
Catalog No. ABIN3384155
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human HEY1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Ha-Ry/enhancer-of-Split Related with YRPW Motif 1 (HEY1)
NCBI Accession:
NM_012258,NP_036390
Species:
Human
Synonyms:
HEY1, Hey1, hey1
Insert length:
1310 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Giacopelli, Cappato, Tonachini, Mura, Di Lascio, Fornasari, Ravazzolo, Bocciardi: "Identification and characterization of regulatory elements in the promoter of ACVR1, the gene mutated in Fibrodysplasia Ossificans Progressiva." in: Orphanet journal of rare diseases, Vol. 8, Issue , pp. 145, 2013 (Pubmed)
Catalog No. ABIN3384403
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human HLCS is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Biotin-Protein Ligase (HLCS)
NCBI Accession:
NM_000411,NP_000402
Species:
Human
Synonyms:
Hlcs, HLCS
Insert length:
3100 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Ingaramo, Beckett: "Distinct amino termini of two human HCS isoforms influence biotin acceptor substrate recognition." in: The Journal of biological chemistry, Vol. 284, Issue 45, pp. 30862-70, 2009 (Pubmed)
Catalog No. ABIN3384448
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human HNRPDL is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Heterogeneous Nuclear Ribonucleoprotein D-Like (HNRPDL)
NCBI Accession:
NM_031372,NP_112740
Species:
Human
Synonyms:
hnrpdl, hnrnpdl, HNRPDL, HNRNPDL, Hnrnpdl1, Hnrnpdl, LOC690144, LOC100351670, LOC101120922
Insert length:
2470 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Moldovan, Moran: "The Zinc-Finger Antiviral Protein ZAP Inhibits LINE and Alu Retrotransposition." in: PLoS genetics, Vol. 11, Issue 5, pp. e1005121, 2015 (Pubmed)
Catalog No. ABIN3384492
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human DDX21 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
DEAD (Asp-Glu-Ala-Asp) Box Polypeptide 21 (DDX21)
NCBI Accession:
NM_004728,NP_004719
Species:
Human
Synonyms:
ddx21, DDX21, Ddx21
Insert length:
3410 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Moldovan, Moran: "The Zinc-Finger Antiviral Protein ZAP Inhibits LINE and Alu Retrotransposition." in: PLoS genetics, Vol. 11, Issue 5, pp. e1005121, 2015 (Pubmed)
Catalog No. ABIN3383610
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human DKC1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Dyskeratosis Congenita 1, Dyskerin (DKC1)
NCBI Accession:
NM_001363,NP_001354
Species:
Human
Synonyms:
DKC1, dkc1, LOC100340288, Dkc1, NAP57
Insert length:
2450 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Moye, Porter, Cohen, Phan, Zyner, Sasaki, Lovrecz, Beck, Bryan: "Telomeric G-quadruplexes are a substrate and site of localization for human telomerase." in: Nature communications, Vol. 6, Issue , pp. 7643, 2015 (Pubmed)
  • Agarwal, Loh, McLoughlin, Huang, Park, Miller, Huo, Okuka, Dos Reis, Loewer, Ng, Keefe, Goldman, Klingelhutz, Liu, Daley: "Telomere elongation in induced pluripotent stem cells from dyskeratosis congenita patients." in: Nature, Vol. 464, Issue 7286, pp. 292-6, 2010 (Pubmed)
Catalog No. ABIN3383663
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human GLI1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Zinc Finger Protein GLI1 (GLI1)
NCBI Accession:
NM_005269,NP_005260
Species:
Human
Synonyms:
GLI1, Gli1, gli1
Insert length:
3600 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Calvisi, Pinna, Ladu, Pellegrino, Simile, Frau, De Miglio, Tomasi, Sanna, Muroni, Feo, Pascale: "Forkhead box M1B is a determinant of rat susceptibility to hepatocarcinogenesis and sustains ERK activity in human HCC." in: Gut, Vol. 58, Issue 5, pp. 679-87, 2009 (Pubmed)
Catalog No. ABIN3384227
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human NET1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Neuroepithelial Cell Transforming 1 (NET1)
NCBI Accession:
NM_005863,NP_005854
Species:
Human
Synonyms:
net1, EDI_348570, NET1, Net1
Insert length:
2620 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • García-Mata, Dubash, Sharek, Carr, Frost, Burridge: "The nuclear RhoA exchange factor Net1 interacts with proteins of the Dlg family, affects their localization, and influences their tumor suppressor activity." in: Molecular and cellular biology, Vol. 27, Issue 24, pp. 8683-97, 2007 (Pubmed)
Catalog No. ABIN3385420
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
  • <
  • 1
  • ...
  • ...
  • ...
  • ...
  • ...