You are viewing an incomplete version of our website. Please click to reload the website as full version.

cDNA Clones

Complementary DNA or in short cDNA is the product of reverse transcription from an RNA template. Typically, mRNA serves as template for the generation of a cDNA in which its poly-(A) tail is used as a primer site for reverse transcriptase. Subsequently, the cDNA product is amplified by PCR. Usually cDNA does not contain any introns and corresponds oftentimes to the actual coding sequence of gene. As such, cDNA is an important intermediate on the way to expressing a protein of interest. A complete cDNA library of a given organism represents its transcriptome. Derived from mRNA and including 5’ and 3’ UTRs, our cDNA collections are ideal for overexpressing a gene in the context of native regulation.
785,868 Products
Data Quality
  • 2024
Type
  • 785868
    Plasmid
Gene
  • 229
  • 226
  • 209
  • 165
  • 163
Species
  • 284091
  • 247452
  • 167151
  • 27699
  • 21907
Insert
  • 785868
    cDNA
  • 365420
  • 249950
  • 39144
  • 40
Vector
  • 442107
  • 247253
  • 87095
  • 9413
Vector Backbone
  • 62464
  • 62463
  • 62463
  • 62463
  • 61225
Fusion tag
  • 291230
  • 187390
  • 62463
  • 61225
  • 61224
Bacterial Resistance
  • 563560
  • 199140
  • 23502
Selectable Marker
  • 335064
  • 14372
  • 57
  • 1
Promoter
  • 264115
  • 247375
  • 182023
  • 9106
  • 803
Expression Type
  • 438754
  • 247431
  • 4217
  • 3174
  • 10
Application
  • 462723
  • 442107
Supplier: Log in to see

Untagged full-length cDNA clone from Human ANGPTL2 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Angiopoietin-Like 2
NCBI Accession:
NM_012098, NP_036230
Species:
Human
Synonyms:
angptl2-a, ANGPTL2, angptl2, LOC100354822, angptl2-b, Angptl2, angptl2b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC
Bacterial Resistance:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Sato, Yamasaki, Hirai, Matsubara, Nomura, Sato, Mimata: "Angiopoietin-like protein 2 induces androgen-independent and malignant behavior in human prostate cancer cells." in: Oncology reports, Vol. 33, Issue 1, pp. 58-66, 2014 (Pubmed)
Catalog No. ABIN3316742
$190.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human RAD18 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
RAD18 Homolog (S. Cerevisiae)
NCBI Accession:
NM_020165, NP_064550
Species:
Human
Synonyms:
rad18, RAD18, Rad18
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC
Bacterial Resistance:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Pentecost, Vashisht, Lester, Voros, Beaty, Park, Wang, Yun, Freiberg, Wohlschlegel, Lee: "Evidence for ubiquitin-regulated nuclear and subnuclear trafficking among Paramyxovirinae matrix proteins." in: PLoS pathogens, Vol. 11, Issue 3, pp. e1004739, 2015 (Pubmed)
Catalog No. ABIN3317039
$190.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human MLH1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
MutL Homolog 1, Colon Cancer, Nonpolyposis Type 2 (E. Coli)
NCBI Accession:
NM_000249, NP_000240
Species:
Human
Synonyms:
MLH1, Mlh1, mlh1, LOC100232198
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC
Bacterial Resistance:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Valeri, Gasparini, Fabbri, Braconi, Veronese, Lovat, Adair, Vannini, Fanini, Bottoni, Costinean, Sandhu, Nuovo, Alder, Gafa, Calore, Ferracin, Lanza, Volinia, Negrini, McIlhatton, Amadori, Fishel et al.: "Modulation of mismatch repair and genomic stability by miR-155. ..." in: Proceedings of the National Academy of Sciences of the United States of America, Vol. 107, Issue 15, pp. 6982-7, 2010 (Pubmed)
Catalog No. ABIN3316956
$190.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human ALDH1A1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Aldehyde Dehydrogenase 1 Family, Member A1
NCBI Accession:
NM_000689, NP_000680
Species:
Human
Synonyms:
ALDH1A1, aldh1a1, aldH1, aldh1, Aldh1a1, Aldh2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC
Bacterial Resistance:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Arnold, Kent, Hogarth, Schlatt, Prasad, Haenisch, Walsh, Muller, Griswold, Amory, Isoherranen: "Importance of ALDH1A enzymes in determining human testicular retinoic acid concentrations." in: Journal of lipid research, Vol. 56, Issue 2, pp. 342-57, 2015 (Pubmed)
  • Yasmeen, Meyers, Alvarez, Thomas, Bonnegarde-Bernard, Alder, Papenfuss, Benson, Boyaka, Ziouzenkova: "Aldehyde dehydrogenase-1a1 induces oncogene suppressor genes in B cell populations." in: Biochimica et biophysica acta, Vol. 1833, Issue 12, pp. 3218-27, 2013 (Pubmed)
  • Keller, Watschinger, Lange, Golderer, Werner-Felmayer, Hermetter, Wanders, Werner: "Studying fatty aldehyde metabolism in living cells with pyrene-labeled compounds." in: Journal of lipid research, Vol. 53, Issue 7, pp. 1410-6, 2012 (Pubmed)
  • Schäfer, Teufel, Ringel, Bettstetter, Hoepner, Rasper, Gempt, Koeritzer, Schmidt-Graf, Meyer, Beier, Schlegel: "Aldehyde dehydrogenase 1A1--a new mediator of resistance to temozolomide in glioblastoma." in: Neuro-oncology, Vol. 14, Issue 12, pp. 1452-64, 2012 (Pubmed)
  • Reichert, Yasmeen, Jeyakumar, Yang, Thomou, Alder, Duester, Maiseyeu, Mihai, Harrison, Rajagopalan, Kirkland, Ziouzenkova: "Concerted action of aldehyde dehydrogenases influences depot-specific fat formation." in: Molecular endocrinology (Baltimore, Md.), Vol. 25, Issue 5, pp. 799-809, 2011 (Pubmed)
Catalog No. ABIN3317224
$190.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human E2F4 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
E2F Transcription Factor 4, P107/p130-Binding
NCBI Accession:
NM_001950, NP_001941
Species:
Human
Synonyms:
E2F4, e2f4, E2f4, e2f5
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC
Bacterial Resistance:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Zhu, Khozoie, Bility, Ferry, Blazanin, Glick, Gonzalez, Peters: "Peroxisome proliferator-activated receptor β/δ cross talks with E2F and attenuates mitosis in HRAS-expressing cells." in: Molecular and cellular biology, Vol. 32, Issue 11, pp. 2065-82, 2012 (Pubmed)
Catalog No. ABIN3317514
$190.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human LDHA is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Lactate Dehydrogenase A
NCBI Accession:
NM_005566, NP_005557
Species:
Human
Synonyms:
ldha, ldha-b, LDHA, Ldha, LOC100357659, ldhb-b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC
Bacterial Resistance:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Zhao, Ren, Tang: "Overcoming 5-Fu resistance in human non-small cell lung cancer cells by the combination of 5-Fu and cisplatin through the inhibition of glucose metabolism." in: Tumour biology, Vol. 35, Issue 12, pp. 12305-15, 2014 (Pubmed)
  • Newington, Rappon, Albers, Wong, Rylett, Cumming et al.: "Overexpression of pyruvate dehydrogenase kinase 1 and lactate dehydrogenase A in nerve cells confers resistance to amyloid β and other toxins by decreasing mitochondrial respiration and reactive ..." in: The Journal of biological chemistry, Vol. 287, Issue 44, pp. 37245-58, 2012 (Pubmed)
Catalog No. ABIN3317788
$190.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human MMP2 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Matrix Metalloproteinase 2
NCBI Accession:
NM_004530, NP_004521
Species:
Human
Synonyms:
MMP2, Mmp2, mmp2, mmp-2, Mmp-2, LOC100135793
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC
Bacterial Resistance:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Tavana, Jovic, Mosadegh, Lee, Liu, Luker, Luker, Weiss, Takayama: "Nanolitre liquid patterning in aqueous environments for spatially defined reagent delivery to mammalian cells." in: Nature materials, Vol. 8, Issue 9, pp. 736-41, 2009 (Pubmed)
  • Higashi, Oeda, Yamamoto, Miyazaki: "Identification of amino acid residues of matrix metalloproteinase-7 essential for binding to cholesterol sulfate." in: The Journal of biological chemistry, Vol. 283, Issue 51, pp. 35735-44, 2008 (Pubmed)
Catalog No. ABIN3317862
$190.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human NDUFV2 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
NADH Dehydrogenase (Ubiquinone) Flavoprotein 2, 24kDa
NCBI Accession:
NM_021074, NP_066552
Species:
Human
Synonyms:
Ndufv2, ndufv2, NDUFV2, NUDFV2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC
Bacterial Resistance:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • De Rasmo, Signorile, Santeramo, Larizza, Lattanzio, Capitanio, Papa: "Intramitochondrial adenylyl cyclase controls the turnover of nuclear-encoded subunits and activity of mammalian complex I of the respiratory chain." in: Biochimica et biophysica acta, Vol. 1853, Issue 1, pp. 183-91, 2014 (Pubmed)
Catalog No. ABIN3317931
$190.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human SIRT7 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Sirtuin 7
NCBI Accession:
NM_016538, NP_057622
Species:
Human
Synonyms:
SIRT7, CH211-258L4.6, PCYT2, Sirt7
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC
Bacterial Resistance:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Aljada, Saleh, Alkathiri, Shamsa, Al-Bawab, Nasr: "Altered Sirtuin 7 Expression is Associated with Early Stage Breast Cancer." in: Breast cancer : basic and clinical research, Vol. 9, Issue , pp. 3-8, 2015 (Pubmed)
Catalog No. ABIN3318262
$190.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human UCP2 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Uncoupling Protein 2 (Mitochondrial, Proton Carrier)
NCBI Accession:
NM_003355, NP_003346
Species:
Human
Synonyms:
PTRG_09289, UCP2, LOC100282746, ucp2, TEgg068n20.1, LOC100534553, Ucp2
Insert length:
1660 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC
Bacterial Resistance:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Fiorini, Cordani, Gotte, Picone, Donadelli: "Onconase induces autophagy sensitizing pancreatic cancer cells to gemcitabine and activates Akt/mTOR pathway in a ROS-dependent manner." in: Biochimica et biophysica acta, Vol. 1853, Issue 3, pp. 549-60, 2015 (Pubmed)
Catalog No. ABIN3318600
$190.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human C1QA is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Complement Component 1, Q Subcomponent, A Chain
NCBI Accession:
NM_015991, NP_057075
Species:
Human
Synonyms:
C1QA, c1qa, C1qa
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC
Bacterial Resistance:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Bally, Ancelet, Moriscot, Gonnet, Mantovani, Daniel, Schoehn, Arlaud, Thielens: "Expression of recombinant human complement C1q allows identification of the C1r/C1s-binding sites." in: Proceedings of the National Academy of Sciences of the United States of America, Vol. 110, Issue 21, pp. 8650-5, 2013 (Pubmed)
Catalog No. ABIN3317325
$190.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human SFRP2 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Secreted Frizzled-Related Protein 2
NCBI Accession:
NM_003013, NP_003004
Species:
Human
Synonyms:
sfrp2, SFRP2, LOAG_01461, Sfrp2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC
Bacterial Resistance:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Sun, Zhu, Chen, Qian, Wei, Chen, Xu: "SFRP2 augments WNT16B signaling to promote therapeutic resistance in the damaged tumor microenvironment." in: Oncogene, Vol. 35, Issue 33, pp. 4321-34, 2016 (Pubmed)
Catalog No. ABIN3319314
$190.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human SLC22A11 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Solute Carrier Family 22 (Organic Cation Transporter), Member 11
NCBI Accession:
NM_018484, NP_060954
Species:
Human
Synonyms:
SLC22A11, LOC100349650
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC
Bacterial Resistance:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Lofthouse, Brooks, Cleal, Hanson, Poore, OKelly, Lewis: "Glutamate cycling may drive organic anion transport on the basal membrane of human placental syncytiotrophoblast." in: The Journal of physiology, Vol. 593, Issue 20, pp. 4549-59, 2015 (Pubmed)
Catalog No. ABIN3319326
$190.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human SOX9 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
SRY (Sex Determining Region Y)-Box 9
NCBI Accession:
NM_000346, NP_000337
Species:
Human
Synonyms:
SOX9, LOC100227849, SOX10, Sox9
Insert length:
2600 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC
Bacterial Resistance:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Luanpitpong, Li, Manke, Brundage, Ellis, McLaughlin, Angsutararux, Chanthra, Voronkova, Chen, Wang, Chanvorachote, Pei, Issaragrisil, Rojanasakul: "SLUG is required for SOX9 stabilization and functions to promote cancer stem cells and metastasis in human lung carcinoma." in: Oncogene, Vol. 35, Issue 22, pp. 2824-33, 2016 (Pubmed)
  • Shakhova, Cheng, Mishra, Zingg, Schaefer, Debbache, Häusel, Matter, Guo, Davis, Meltzer, Mihic-Probst, Moch, Wegner, Merlino, Levesque, Dummer, Santoro, Cinelli, Sommer: "Antagonistic cross-regulation between Sox9 and Sox10 controls an anti-tumorigenic program in melanoma." in: PLoS genetics, Vol. 11, Issue 1, pp. e1004877, 2015 (Pubmed)
  • Ikhapoh, Pelham, Agrawal: "Sry-type HMG box 18 contributes to the differentiation of bone marrow-derived mesenchymal stem cells to endothelial cells." in: Differentiation; research in biological diversity, Vol. 89, Issue 3-4, pp. 87-96, 2015 (Pubmed)
  • Matsushima, Kuroki, Kitasato, Adachi, Tanaka, Hirabaru, Hirayama, Kuroshima, Hidaka, Soyama, Takatsuki, Kinoshita, Sano, Nishida, Eguchi: "Sox9 expression in carcinogenesis and its clinical significance in intrahepatic cholangiocarcinoma." in: Digestive and liver disease : official journal of the Italian Society of Gastroenterology and the Italian Association for the Study of the Liver, Vol. 47, Issue 12, pp. 1067-75, 2015 (Pubmed)
  • Bobick, Alexander, Tuan: "High efficiency transfection of embryonic limb mesenchyme with plasmid DNA using square wave pulse electroporation and sucrose buffer." in: BioTechniques, Vol. 56, Issue 2, pp. 85-9, 2014 (Pubmed)
  • Needham, Shah, Dahlin, Kinard, Lam, Watson, Lu, Kasper, Mikos: "Osteochondral tissue regeneration through polymeric delivery of DNA encoding for the SOX trio and RUNX2." in: Acta biomaterialia, Vol. 10, Issue 10, pp. 4103-12, 2014 (Pubmed)
  • Mata-Rocha, Hernández-Sánchez, Guarneros, de la Chesnaye, Sánchez-Tusié, Treviño, Felix, Oviedo: "The transcription factors Sox5 and Sox9 regulate Catsper1 gene expression." in: FEBS letters, Vol. 588, Issue 18, pp. 3352-60, 2014 (Pubmed)
  • Show more References
Catalog No. ABIN3319363
$190.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human LRG1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Leucine-Rich alpha-2 Glycoprotein 1
NCBI Accession:
NM_052972, NP_443204
Species:
Human
Synonyms:
si:dkey-90m5.4, LRG1, lrg1, Lrg1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC
Bacterial Resistance:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Guergova-Kuras, Kurucz, Hempel, Tardieu, Kádas, Malderez-Bloes, Jullien, Kieffer, Hincapie, Guttman, Csánky, Dezso, Karger, Takács: "Discovery of lung cancer biomarkers by profiling the plasma proteome with monoclonal antibody libraries." in: Molecular & cellular proteomics : MCP, Vol. 10, Issue 12, pp. M111.010298, 2011 (Pubmed)
Catalog No. ABIN3319052
$190.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human KPNA2 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Karyopherin alpha 2 (RAG Cohort 1, Importin alpha 1)
NCBI Accession:
NM_002266, NP_002257
Species:
Human
Synonyms:
EDI_246290, EDI_335040, ima2, kpna2, Kpna2, KPNA2, Kpna7
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC
Bacterial Resistance:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Wang, Zhao, Bi, Sun, Liu, Liu: "Tyrosine 132 phosphorylation of influenza A virus M1 protein is crucial for virus replication by controlling the nuclear import of M1." in: Journal of virology, Vol. 87, Issue 11, pp. 6182-91, 2013 (Pubmed)
Catalog No. ABIN3319028
$190.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human SUZ12 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
SUZ12 Polycomb Repressive Complex 2 Subunit
NCBI Accession:
NM_015355, NP_056170
Species:
Human
Insert length:
4470 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Bacterial Resistance:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Bhatnagar, Gazin, Chamberlain, Ou, Zhu, Tushir, Virbasius, Lin, Zhu, Wajapeyee, Green: "TRIM37 is a new histone H2A ubiquitin ligase and breast cancer oncoprotein." in: Nature, Vol. 516, Issue 7529, pp. 116-20, 2014 (Pubmed)
Catalog No. ABIN3380235
$190.00
1 kit
Will be delivered in 16 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human TRAF6 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
TNF Receptor-Associated Factor 6
NCBI Accession:
NM_145803, NP_665802
Species:
Human
Synonyms:
traf6-b, Traf6, TRAF6, traf6
Insert length:
4000 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Bacterial Resistance:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Zhou, Wang, Schwartz, Stoffels, Park, Zhang, Yang, Demirkaya, Takeuchi, Tsai, Lyons, Yu, Ouyang, Chen, Chin, Zaal, Chandrasekharappa, P Hanson, Yu, Mullikin, Hasni, Wertz, Ombrello, Stone, Hoffmann et al.: "Loss-of-function mutations in TNFAIP3 leading to A20 haploinsufficiency cause an early-onset autoinflammatory disease. ..." in: Nature genetics, Vol. 48, Issue 1, pp. 67-73, 2015 (Pubmed)
  • Palamarchuk, Efanov, Nazaryan, Santanam, Alder, Rassenti, Kipps, Croce, Pekarsky: "13q14 deletions in CLL involve cooperating tumor suppressors." in: Blood, Vol. 115, Issue 19, pp. 3916-22, 2010 (Pubmed)
Catalog No. ABIN3380443
$190.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human WNT4 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Wingless-Type MMTV Integration Site Family, Member 4
NCBI Accession:
NM_030761, NP_110388
Species:
Human
Synonyms:
WNT4, Wnt4, LOC100230804, wnt4, wnt4a
Insert length:
2500 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Bacterial Resistance:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Ring, Neth, Weber, Steffens, Faussner et al.: "β-Catenin-dependent pathway activation by both promiscuous "canonical" WNT3a-, and specific "noncanonical" WNT4- and WNT5a-FZD receptor combinations with strong differences in LRP5 and LRP6 ..." in: Cellular signalling, Vol. 26, Issue 2, pp. 260-7, 2013 (Pubmed)
Catalog No. ABIN3380666
$190.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human VTI1B is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Vesicle Transport through Interaction with T-SNAREs Homolog 1B (Yeast)
NCBI Accession:
NM_006370, NP_006361
Species:
Human
Synonyms:
vti1b, VTI1B, RGD1560475, Vti1b
Insert length:
5550 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Bacterial Resistance:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Cheng, Cebotaru, Cebotaru, Guggino: "Syntaxin 6 and CAL mediate the degradation of the cystic fibrosis transmembrane conductance regulator." in: Molecular biology of the cell, Vol. 21, Issue 7, pp. 1178-87, 2010 (Pubmed)
Catalog No. ABIN3380631
$190.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human ATF4 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Activating Transcription Factor 4 (Tax-Responsive Enhancer Element B67)
NCBI Accession:
NM_001675, NP_001666
Species:
Human
Synonyms:
ATF4, atf4-a, atf4b1, atf4, atf4b2, Atf4
Insert length:
1200 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Bacterial Resistance:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Zhang, Lee, Min, McEntee, Jeong, Li, Baek: "The involvement of endoplasmic reticulum stress in the suppression of colorectal tumorigenesis by tolfenamic acid." in: Cancer prevention research (Philadelphia, Pa.), Vol. 6, Issue 12, pp. 1337-47, 2013 (Pubmed)
  • Armstrong, Flockhart, Veal, Lovat, Redfern: "Regulation of endoplasmic reticulum stress-induced cell death by ATF4 in neuroectodermal tumor cells." in: The Journal of biological chemistry, Vol. 285, Issue 9, pp. 6091-100, 2010 (Pubmed)
Catalog No. ABIN3382640
$190.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human ATP6V1A is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
ATPase, H+ Transporting, Lysosomal 70kDa, V1 Subunit A
NCBI Accession:
NM_001690, NP_001681
Species:
Human
Synonyms:
ATP6V1A, atp6v1aa, ANI_1_1468024, AOR_1_602134, atp6v1a, Atp6v0a1, Atp6v1a, Vha68-1, vpp3
Insert length:
2880 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Bacterial Resistance:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Adamson, Chohan, Swenson, LaJeunesse: "A Drosophila model for genetic analysis of influenza viral/host interactions." in: Genetics, Vol. 189, Issue 2, pp. 495-506, 2011 (Pubmed)
Catalog No. ABIN3382667
$190.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human BAD is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
BCL2-Associated Agonist of Cell Death
NCBI Accession:
NM_004322, NP_004313
Species:
Human
Synonyms:
badb, BAD, Bad
Insert length:
1110 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Bacterial Resistance:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Cain, Hauptschein, Stewart, Bagci, Sahagian, Jay: "Identification of CD44 as a surface biomarker for drug resistance by surface proteome signature technology." in: Molecular cancer research : MCR, Vol. 9, Issue 5, pp. 637-47, 2011 (Pubmed)
  • Anderson, Sutherland, Butt: "BAG-1 overexpression attenuates luminal apoptosis in MCF-10A mammary epithelial cells through enhanced RAF-1 activation." in: Oncogene, Vol. 29, Issue 4, pp. 527-38, 2010 (Pubmed)
Catalog No. ABIN3382708
$190.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human BACE1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
beta-Site APP-Cleaving Enzyme 1
NCBI Accession:
NM_012104, NP_036236
Species:
Human
Synonyms:
BACE1, MGC145931, LOC100232107, bace2, BACE2, LOC100224177, Bace1, bace1
Insert length:
3270 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Bacterial Resistance:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Fisher, Resnick, De, Acevedo, Lu, Schroeder, Nicholson: "Cyclic cis-Locked Phospho-Dipeptides Reduce Entry of AβPP into Amyloidogenic Processing Pathway." in: Journal of Alzheimer's disease : JAD, Vol. 55, Issue 1, pp. 391-410, 2016 (Pubmed)
  • Atkin, Hunt, Minakawa, Sharkey, Tipper, Tennant, Paulson: "F-box only protein 2 (Fbxo2) regulates amyloid precursor protein levels and processing." in: The Journal of biological chemistry, Vol. 289, Issue 10, pp. 7038-48, 2014 (Pubmed)
  • Wang, Wilfred, Madathil, Tang, Hu, Dimayuga, Stromberg, Huang, Saatman, Nelson: "miR-107 regulates granulin/progranulin with implications for traumatic brain injury and neurodegenerative disease." in: The American journal of pathology, Vol. 177, Issue 1, pp. 334-45, 2010 (Pubmed)
  • Minopoli, Passaro, Aloia, Carlomagno, Melillo, Santoro, Forzati, Zambrano, Russo: "Receptor- and non-receptor tyrosine kinases induce processing of the amyloid precursor protein: role of the low-density lipoprotein receptor-related protein." in: Neuro-degenerative diseases, Vol. 4, Issue 2-3, pp. 94-100, 2007 (Pubmed)
Catalog No. ABIN3382704
$190.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human BCL2L1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
BCL2-Like 1
NCBI Accession:
NM_138578, NP_612815
Species:
Human
Synonyms:
bcl2l1, BCL2L1, LOC100224900, Tg(BCL2L1)2Cbt, Bcl2l1
Insert length:
2380 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Bacterial Resistance:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Fouqué, Lepvrier, Debure, Gouriou, Malleter, Delcroix, Ovize, Ducret, Li, Hammadi, Vacher, Legembre: "The apoptotic members CD95, BclxL, and Bcl-2 cooperate to promote cell migration by inducing Ca(2+) flux from the endoplasmic reticulum to mitochondria." in: Cell death and differentiation, Vol. 23, Issue 10, pp. 1702-16, 2016 (Pubmed)
Catalog No. ABIN3382739
$190.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human BRD7 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Bromodomain Containing 7
NCBI Accession:
NM_013263, NP_037395
Species:
Human
Synonyms:
brd7, BRD7, Brd7
Insert length:
3200 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Bacterial Resistance:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Tae, Karkhanis, Velasco, Yaneva, Erdjument-Bromage, Tempst, Sif: "Bromodomain protein 7 interacts with PRMT5 and PRC2, and is involved in transcriptional repression of their target genes." in: Nucleic acids research, Vol. 39, Issue 13, pp. 5424-38, 2011 (Pubmed)
Catalog No. ABIN3382797
$190.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human CAMK4 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Calcium/calmodulin-Dependent Protein Kinase IV
NCBI Accession:
NM_001744, NP_001735
Species:
Human
Synonyms:
CAMK4L, CAMK4, camk4, Camk4
Insert length:
2620 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Bacterial Resistance:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Shen, Gloster, Yuzwa, Vocadlo: "Insights into O-linked N-acetylglucosamine ([0-9]O-GlcNAc) processing and dynamics through kinetic analysis of O-GlcNAc transferase and O-GlcNAcase activity on protein substrates." in: The Journal of biological chemistry, Vol. 287, Issue 19, pp. 15395-408, 2012 (Pubmed)
Catalog No. ABIN3383006
$190.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human CDC6 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Cell Division Cycle 6 Homolog (S. Cerevisiae)
NCBI Accession:
NM_001254, NP_001245
Species:
Human
Synonyms:
CDC6, Cdc6
Insert length:
2870 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Bacterial Resistance:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Liu, Gong, Sun, Li: "FOXM1 and androgen receptor co-regulate CDC6 gene transcription and DNA replication in prostate cancer cells." in: Biochimica et biophysica acta, Vol. 1839, Issue 4, pp. 297-305, 2014 (Pubmed)
Catalog No. ABIN3383190
$190.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human CDK9 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Cyclin-Dependent Kinase 9
NCBI Accession:
NM_001261, NP_001252
Species:
Human
Synonyms:
Cdk9, CDK9, cdk9, cdk9-a, LOC100855805
Insert length:
1910 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Bacterial Resistance:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Sayed, Yang, He, Pfleger, Abdellatif: "Acute targeting of general transcription factor IIB restricts cardiac hypertrophy via selective inhibition of gene transcription." in: Circulation. Heart failure, Vol. 8, Issue 1, pp. 138-48, 2015 (Pubmed)
  • Moldovan, Moran: "The Zinc-Finger Antiviral Protein ZAP Inhibits LINE and Alu Retrotransposition." in: PLoS genetics, Vol. 11, Issue 5, pp. e1005121, 2015 (Pubmed)
  • Ma, Chen, Wright, Pillai, Chellappan, Cress: "CDKN1C negatively regulates RNA polymerase II C-terminal domain phosphorylation in an E2F1-dependent manner." in: The Journal of biological chemistry, Vol. 285, Issue 13, pp. 9813-22, 2010 (Pubmed)
Catalog No. ABIN3383219
$190.00
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human CXCL10 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Chemokine (C-X-C Motif) Ligand 10
NCBI Accession:
NM_001565, NP_001556
Species:
Human
Synonyms:
CXCL10, cxl10, Cxcl10
Insert length:
1140 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Bacterial Resistance:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Barash, Zohar, Wildbaum, Beider, Nagler, Karin, Ilan, Vlodavsky: "Heparanase enhances myeloma progression via CXCL10 downregulation." in: Leukemia, Vol. 28, Issue 11, pp. 2178-87, 2014 (Pubmed)
Catalog No. ABIN3383530
$190.00
1 kit
Will be delivered in 8 to 11 Business Days
  • <
  • 1
  • ...
  • ...
  • ...
  • ...