You are viewing an incomplete version of our website. Please click to reload the website as full version.

Expression-ready ORF Clones

An open reading frame (ORF) is the region of a nucleotide sequence from a start codon to stop codon. In case of eukaryotic ORFs this might also include introns. In practical terms however, an ORF corresponds to the coding sequence (CDS) constituted by concatenated exons that is actually translated to from a protein. Free of any regulatory sequences and with both the 5’ and 3’ UTR removed, our ORF clones provide a shortcut to protein expression or subcloning.
219,740 Products
Data Quality
  • 1
Type
  • 219740
    Plasmid
Gene
  • 997
  • 161
  • 104
  • 104
  • 95
Species
  • 120220
  • 64807
  • 16907
  • 5988
  • 3338
Insert
  • 809074
  • 365420
  • 219740
    ORF
  • 39144
  • 2
Vector
  • 179860
  • 30331
  • 9548
  • 1
Vector Backbone
  • 15177
  • 14943
  • 14579
  • 14565
  • 14563
Fusion tag
  • 45737
  • 29708
  • 29190
  • 29160
  • 29128
Bacterial Resistance
  • 174837
  • 25098
  • 19805
Selectable Marker
  • 179802
  • 9548
Promoter
  • 189408
Expression Type
  • 189387
Application
  • 219739
  • 1
Supplier: Log in to see
ISO 9001:2008

Full length Clone DNA of Mus musculus calreticulin with C terminal His tag.

Type:
ORF
Application:
Protein Expression
Gene:
Calreticulin
NCBI Accession:
NM_007591
Species:
Mouse (Murine)
Synonyms:
calr, crt, CRT, Crc, LmjF31.2600, CALR, Calr, Crt, CRT2, CALR3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-His
Bacterial Resistance:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable
Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Publications
  • Huang, Sun, Wu, Shui, Han, Guo, Li: "Calreticulin Promotes Proliferation and Migration But Inhibits Apoptosis in Schwann Cells." in: Medical science monitor : international medical journal of experimental and clinical research, Vol. 22, Issue , pp. 4516-4522, 2016 (Pubmed)
Catalog No. ABIN3967500
$269.50
1 vial
Will be delivered in 16 to 21 Business Days
Supplier: Log in to see

The lentiviral annexin A1 ORF expression vector was created to enable expression of the protein with a V5 fusion tag.

Type:
ORF
Application:
Protein Expression
Gene:
Annexin A1
Gene ID:
301 (Human, ANXA1)
Synonyms:
anxa1a, anxa1, ANXA1, LOC100222491, LOC100335033, Anxa1
Vector type:
Lentiviral Vector
Vector backbone:
pLX304
Bacterial Resistance:
Ampicillin
Selection Marker:
Blasticidin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
V5 tag
Expression:
Transient,Stable
Sequencing Primer:
  • 3-1291
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3398692
$550.00
1 vial
Will be delivered in 6 to 8 Business Days
Supplier: Log in to see

The lentiviral aquaporin 4 ORF expression vector was created to enable expression of the protein with a V5 fusion tag.

Type:
ORF
Application:
Protein Expression
Gene:
Aquaporin 4
Gene ID:
361 (Human, AQP4)
Synonyms:
aqp4, AQP4, LOC100232616, Aqp4
Vector type:
Lentiviral Vector
Vector backbone:
pLX304
Bacterial Resistance:
Ampicillin
Selection Marker:
Blasticidin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
V5 tag
Expression:
Transient,Stable
Sequencing Primer:
  • 3-1291
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3398698
$550.00
1 vial
Will be delivered in 6 to 8 Business Days
Supplier: Log in to see

The lentiviral lumican ORF expression vector was created to enable expression of the protein with a V5 fusion tag.

Type:
ORF
Application:
Protein Expression
Gene:
Lumican
Gene ID:
4060 (Human, LUM)
Synonyms:
LUM, lum, CpipJ_CPIJ010209, Lum
Vector type:
Lentiviral Vector
Vector backbone:
pLX304
Bacterial Resistance:
Ampicillin
Selection Marker:
Blasticidin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
V5 tag
Expression:
Transient,Stable
Sequencing Primer:
  • 3-1291
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3398699
$550.00
1 vial
Will be delivered in 6 to 8 Business Days
Supplier: Log in to see

The lentiviral butyrylcholinesterase ORF expression vector was created to enable expression of the protein with a V5 fusion tag.

Type:
ORF
Application:
Protein Expression
Gene:
Butyrylcholinesterase
Gene ID:
590 (Human, BCHE)
Synonyms:
bche, BCHE, Bche, LOC100624138, LOC100338759
Vector type:
Lentiviral Vector
Vector backbone:
pLX304
Bacterial Resistance:
Ampicillin
Selection Marker:
Blasticidin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
V5 tag
Expression:
Transient,Stable
Sequencing Primer:
  • 3-1291
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3398765
$550.00
1 vial
Will be delivered in 6 to 8 Business Days
Supplier: Log in to see

The lentiviral synaptophysin ORF expression vector was created to enable expression of the protein with a V5 fusion tag.

Type:
ORF
Application:
Protein Expression
Gene:
Synaptophysin
Gene ID:
6855 (Human, SYP)
Synonyms:
syp-B, SYP, syp, Syp, syp-a, sypa
Vector type:
Lentiviral Vector
Vector backbone:
pLX304
Bacterial Resistance:
Ampicillin
Selection Marker:
Blasticidin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
V5 tag
Expression:
Transient,Stable
Sequencing Primer:
  • 3-1291
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3398869
$550.00
1 vial
Will be delivered in 6 to 8 Business Days
Supplier: Log in to see

The lentiviral glutathione transferase zeta 1 ORF expression vector was created to enable expression of the protein with a V5 fusion tag.

Type:
ORF
Application:
Protein Expression
Gene:
Glutathione Transferase zeta 1 (Maleylacetoacetate Isomerase)
Gene ID:
2954 (Human, GSTZ1)
Synonyms:
gstz1, maiA, hmgC, Patl_1448, Pnap_2807, Daci_3597, Daci_3700, Bind_0562, Bphyt_0577, Dtpsy_1678, Hbal_2638, mai, BC1002_0299, Fbal_2576, Mesop_3937, GstZ1, GSTZ1, Gstz1
Vector type:
Lentiviral Vector
Vector backbone:
pLX304
Bacterial Resistance:
Ampicillin
Selection Marker:
Blasticidin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
V5 tag
Expression:
Transient,Stable
Sequencing Primer:
  • 3-1291
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3399350
$550.00
1 vial
Will be delivered in 6 to 8 Business Days
Supplier: Log in to see

The lentiviral claudin 3 ORF expression vector was created to enable expression of the protein with a V5 fusion tag.

Type:
ORF
Application:
Protein Expression
Gene:
Claudin 3
Gene ID:
1365 (Human, CLDN3)
Synonyms:
cldn3, CLDN3, LOC100228090, Cldn3, LOC100341220
Vector type:
Lentiviral Vector
Vector backbone:
pLX304
Bacterial Resistance:
Ampicillin
Selection Marker:
Blasticidin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
V5 tag
Expression:
Transient,Stable
Sequencing Primer:
  • 3-1291
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3399359
$550.00
1 vial
Will be delivered in 6 to 8 Business Days
Supplier: Log in to see

The lentiviral legumain ORF expression vector was created to enable expression of the protein with a V5 fusion tag.

Type:
ORF
Application:
Protein Expression
Gene:
Legumain
Gene ID:
5641 (Human, LGMN)
Synonyms:
LOC100053265, lgmn, LGMN, DELTA-VPE, Mboo_1489, Odosp_3582, Lgmn
Vector type:
Lentiviral Vector
Vector backbone:
pLX304
Bacterial Resistance:
Ampicillin
Selection Marker:
Blasticidin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
V5 tag
Expression:
Transient,Stable
Sequencing Primer:
  • 3-1291
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3399469
$550.00
1 vial
Will be delivered in 6 to 8 Business Days
Supplier: Log in to see

The lentiviral versican ORF expression vector was created to enable expression of the protein with a V5 fusion tag.

Type:
ORF
Application:
Protein Expression
Gene:
Versican
Gene ID:
1462 (Human, Vcan)
Synonyms:
vcana, vcanb, VCAN, vcan, Vcan, LOC100008666
Vector type:
Lentiviral Vector
Vector backbone:
pLX304
Bacterial Resistance:
Ampicillin
Selection Marker:
Blasticidin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
V5 tag
Expression:
Transient,Stable
Sequencing Primer:
  • 3-1291
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3399716
$550.00
1 vial
Will be delivered in 6 to 8 Business Days
Supplier: Log in to see

The lentiviral cyclin E2 ORF expression vector was created to enable expression of the protein with a V5 fusion tag.

Type:
ORF
Application:
Protein Expression
Gene:
Cyclin E2
Gene ID:
9134 (Human, CCNE2)
Synonyms:
CCNE2, ccne2, cycE1, Ccne2
Vector type:
Lentiviral Vector
Vector backbone:
pLX304
Bacterial Resistance:
Ampicillin
Selection Marker:
Blasticidin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
V5 tag
Expression:
Transient,Stable
Sequencing Primer:
  • 3-1291
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3398706
$550.00
1 vial
Will be delivered in 6 to 8 Business Days
Supplier: Log in to see

The lentiviral apolipoprotein F ORF expression vector was created to enable expression of the protein with a V5 fusion tag.

Type:
ORF
Application:
Protein Expression
Gene:
Apolipoprotein F
Gene ID:
319 (Human, APOF)
Synonyms:
APOF, apof, Apof, LOC100344720
Vector type:
Lentiviral Vector
Vector backbone:
pLX304
Bacterial Resistance:
Ampicillin
Selection Marker:
Blasticidin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
V5 tag
Expression:
Transient,Stable
Sequencing Primer:
  • 3-1291
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3398725
$550.00
1 vial
Will be delivered in 6 to 8 Business Days
Supplier: Log in to see

The lentiviral cullin 3 ORF expression vector was created to enable expression of the protein with a V5 fusion tag.

Type:
ORF
Application:
Protein Expression
Gene:
Cullin 3
Gene ID:
8452 (Human, CUL3)
Synonyms:
CUL3, cul3, cul3-a, cul3-b, PTRG_11586, Smp_117580, cul3a, Cul3, cul-3
Vector type:
Lentiviral Vector
Vector backbone:
pLX304
Bacterial Resistance:
Ampicillin
Selection Marker:
Blasticidin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
V5 tag
Expression:
Transient,Stable
Sequencing Primer:
  • 3-1291
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3399840
$550.00
1 vial
Will be delivered in 6 to 8 Business Days
Supplier: Log in to see

The lentiviral parvalbumin ORF expression vector was created to enable expression of the protein with a V5 fusion tag.

Type:
ORF
Application:
Protein Expression
Gene:
Parvalbumin
Gene ID:
5816 (Human, PVALB)
Synonyms:
PVALB, pvalb7, pvalb, pvalb3, Pvalb, LOC396531, PVALB1
Vector type:
Lentiviral Vector
Vector backbone:
pLX304
Bacterial Resistance:
Ampicillin
Selection Marker:
Blasticidin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
V5 tag
Expression:
Transient,Stable
Sequencing Primer:
  • 3-1291
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3399626
$550.00
1 vial
Will be delivered in 6 to 8 Business Days
Supplier: Log in to see

The lentiviral gastrin ORF expression vector was created to enable expression of the protein with a V5 fusion tag.

Type:
ORF
Application:
Protein Expression
Gene:
Gastrin
Gene ID:
2520 (Human, GAST)
Synonyms:
GAST, Gast, LOC100345451, PAGR1
Vector type:
Lentiviral Vector
Vector backbone:
pLX304
Bacterial Resistance:
Ampicillin
Selection Marker:
Blasticidin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
V5 tag
Expression:
Transient,Stable
Sequencing Primer:
  • 3-1291
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3399625
$550.00
1 vial
Will be delivered in 6 to 8 Business Days
Supplier: Log in to see

The lentiviral melanin-concentrating hormone receptor 1 ORF expression vector was created to enable expression of the protein with a V5 fusion tag.

Type:
ORF
Application:
Protein Expression
Gene:
Melanin-Concentrating Hormone Receptor 1
Gene ID:
2847 (Human, MCHR1)
Synonyms:
MCHR1, Mchr1
Vector type:
Lentiviral Vector
Vector backbone:
pLX304
Bacterial Resistance:
Ampicillin
Selection Marker:
Blasticidin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
V5 tag
Expression:
Transient,Stable
Sequencing Primer:
  • 3-1291
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3400169
$550.00
1 vial
Will be delivered in 6 to 8 Business Days
Supplier: Log in to see

The lentiviral flotillin 1 ORF expression vector was created to enable expression of the protein with a V5 fusion tag.

Type:
ORF
Application:
Protein Expression
Gene:
Flotillin 1
Gene ID:
10211 (Human, FLOT1)
Synonyms:
AaeL_AAEL015235, AaeL_AAEL012046, CpipJ_CPIJ008623, Smp_016200.3, Smp_016200.4, Smp_016200.1, flot1, flot1-b, flot1-a, FLOT1, Flot1, flot1a
Vector type:
Lentiviral Vector
Vector backbone:
pLX304
Bacterial Resistance:
Ampicillin
Selection Marker:
Blasticidin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
V5 tag
Expression:
Transient,Stable
Sequencing Primer:
  • 3-1291
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3400178
$550.00
1 vial
Will be delivered in 6 to 8 Business Days
Supplier: Log in to see

The lentiviral mucolipin 1 ORF expression vector was created to enable expression of the protein with a V5 fusion tag.

Type:
ORF
Application:
Protein Expression
Gene:
Mucolipin 1
Gene ID:
57192 (Human, MCOLN1)
Synonyms:
mcoln1a, MCOLN1, mcoln1, LOAG_04987, Mcoln1
Vector type:
Lentiviral Vector
Vector backbone:
pLX304
Bacterial Resistance:
Ampicillin
Selection Marker:
Blasticidin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
V5 tag
Expression:
Transient,Stable
Sequencing Primer:
  • 3-1291
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3400210
$550.00
1 vial
Will be delivered in 6 to 8 Business Days
Supplier: Log in to see

The lentiviral sulfatase 1 ORF expression vector was created to enable expression of the protein with a V5 fusion tag.

Type:
ORF
Application:
Protein Expression
Gene:
Sulfatase 1
Gene ID:
23213 (Human, SULF1)
Synonyms:
SULF1, Sulf1, sulf1
Vector type:
Lentiviral Vector
Vector backbone:
pLX304
Bacterial Resistance:
Ampicillin
Selection Marker:
Blasticidin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
V5 tag
Expression:
Transient,Stable
Sequencing Primer:
  • 3-1291
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3399752
$550.00
1 vial
Will be delivered in 6 to 8 Business Days
Supplier: Log in to see

The lentiviral synaptotagmin V ORF expression vector was created to enable expression of the protein with a V5 fusion tag.

Type:
ORF
Application:
Protein Expression
Gene:
Synaptotagmin V
Gene ID:
6861 (Human, SYT5)
Synonyms:
SYTL5, Sytbeta, syt5a, SYT5, NTMC2T2.1, Syt9, Syt5, LOC100626439
Vector type:
Lentiviral Vector
Vector backbone:
pLX304
Bacterial Resistance:
Ampicillin
Selection Marker:
Blasticidin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
V5 tag
Expression:
Transient,Stable
Sequencing Primer:
  • 3-1291
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3400374
$550.00
1 vial
Will be delivered in 6 to 8 Business Days
Supplier: Log in to see

The lentiviral lamin A/C ORF expression vector was created to enable expression of the protein with a V5 fusion tag.

Type:
ORF
Application:
Protein Expression
Gene:
Lamin A/C
Gene ID:
4000 (Human, LMNA)
Synonyms:
Lam, lmna, LMNA, lmnb3, Lmna
Vector type:
Lentiviral Vector
Vector backbone:
pLX304
Bacterial Resistance:
Ampicillin
Selection Marker:
Blasticidin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
V5 tag
Expression:
Transient,Stable
Sequencing Primer:
  • 3-1291
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3399789
$550.00
1 vial
Will be delivered in 6 to 8 Business Days
Supplier: Log in to see

The lentiviral synaptotagmin VI ORF expression vector was created to enable expression of the protein with a V5 fusion tag.

Type:
ORF
Application:
Protein Expression
Gene:
Synaptotagmin VI
Gene ID:
148281 (Human, SYT6)
Synonyms:
SYT6, LOC100353541, syt6, Syt6
Vector type:
Lentiviral Vector
Vector backbone:
pLX304
Bacterial Resistance:
Ampicillin
Selection Marker:
Blasticidin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
V5 tag
Expression:
Transient,Stable
Sequencing Primer:
  • 3-1291
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3400393
$550.00
1 vial
Will be delivered in 6 to 8 Business Days
Supplier: Log in to see

The lentiviral synaptogyrin 4 ORF expression vector was created to enable expression of the protein with a V5 fusion tag.

Type:
ORF
Application:
Protein Expression
Gene:
Synaptogyrin 4
Gene ID:
23546 (Human, SYNGR4)
Synonyms:
SYNGR4, Syngr4
Vector type:
Lentiviral Vector
Vector backbone:
pLX304
Bacterial Resistance:
Ampicillin
Selection Marker:
Blasticidin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
V5 tag
Expression:
Transient,Stable
Sequencing Primer:
  • 3-1291
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3399062
$550.00
1 vial
Will be delivered in 6 to 8 Business Days
Supplier: Log in to see

The lentiviral advillin ORF expression vector was created to enable expression of the protein with a V5 fusion tag.

Type:
ORF
Application:
Protein Expression
Gene:
Advillin
Gene ID:
10677 (Human, AVIL)
Synonyms:
AVIL, Adv, avil, CpipJ_CPIJ004696, Avil
Vector type:
Lentiviral Vector
Vector backbone:
pLX304
Bacterial Resistance:
Ampicillin
Selection Marker:
Blasticidin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
V5 tag
Expression:
Transient,Stable
Sequencing Primer:
  • 3-1291
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3399101
$550.00
1 vial
Will be delivered in 6 to 8 Business Days
Supplier: Log in to see

The lentiviral apelin ORF expression vector was created to enable expression of the protein with a V5 fusion tag.

Type:
ORF
Application:
Protein Expression
Gene:
Apelin
Gene ID:
8862 (Human, APLN)
Synonyms:
apln, APLN, apln-b, Apln, LOC100625006, LOC100346492
Vector type:
Lentiviral Vector
Vector backbone:
pLX304
Bacterial Resistance:
Ampicillin
Selection Marker:
Blasticidin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
V5 tag
Expression:
Transient,Stable
Sequencing Primer:
  • 3-1291
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3399249
$550.00
1 vial
Will be delivered in 6 to 8 Business Days
Supplier: Log in to see

The lentiviral cyclin C ORF expression vector was created to enable expression of the protein with a V5 fusion tag.

Type:
ORF
Application:
Protein Expression
Gene:
Cyclin C
Gene ID:
892 (Human, CCNC)
Synonyms:
CycC, ccnc, CCNC, Ccnc, AaeL_AAEL013397
Vector type:
Lentiviral Vector
Vector backbone:
pLX304
Bacterial Resistance:
Ampicillin
Selection Marker:
Blasticidin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
V5 tag
Expression:
Transient,Stable
Sequencing Primer:
  • 3-1291
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3398738
$550.00
1 vial
Will be delivered in 6 to 8 Business Days
Supplier: Log in to see

The lentiviral claudin 15 ORF expression vector was created to enable expression of the protein with a V5 fusion tag.

Type:
ORF
Application:
Protein Expression
Gene:
Claudin 15
Gene ID:
24146 (Human, CLDN15)
Synonyms:
Cldn15, CLDN15, cldn15a, cldn15b, LOC100219596, LOC100357702
Vector type:
Lentiviral Vector
Vector backbone:
pLX304
Bacterial Resistance:
Ampicillin
Selection Marker:
Blasticidin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
V5 tag
Expression:
Transient,Stable
Sequencing Primer:
  • 3-1291
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3399265
$550.00
1 vial
Will be delivered in 6 to 8 Business Days
Supplier: Log in to see

The lentiviral cystatin SN ORF expression vector was created to enable expression of the protein with a V5 fusion tag.

Type:
ORF
Application:
Protein Expression
Gene:
Cystatin SN
Gene ID:
1469 (Human, CST1)
Synonyms:
cystatin 1, CST1
Vector type:
Lentiviral Vector
Vector backbone:
pLX304
Bacterial Resistance:
Ampicillin
Selection Marker:
Blasticidin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
V5 tag
Expression:
Transient,Stable
Sequencing Primer:
  • 3-1291
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3399284
$550.00
1 vial
Will be delivered in 6 to 8 Business Days
Supplier: Log in to see

The lentiviral ninjurin 1 ORF expression vector was created to enable expression of the protein with a V5 fusion tag.

Type:
ORF
Application:
Protein Expression
Gene:
Ninjurin 1
Gene ID:
4814 (Human, NINJ1)
Synonyms:
NINJ1, ninj1, LOC100357710, Ninj1
Vector type:
Lentiviral Vector
Vector backbone:
pLX304
Bacterial Resistance:
Ampicillin
Selection Marker:
Blasticidin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
V5 tag
Expression:
Transient,Stable
Sequencing Primer:
  • 3-1291
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3398959
$550.00
1 vial
Will be delivered in 6 to 8 Business Days
Supplier: Log in to see

The lentiviral transketolase ORF expression vector was created to enable expression of the protein with a V5 fusion tag.

Type:
ORF
Application:
Protein Expression
Gene:
Transketolase
Gene ID:
7086 (Human, TKT)
Synonyms:
CG8036, Transketolase, transketolase, tktl2, tkt, Tb927.8.6170, Tkt, TKT
Vector type:
Lentiviral Vector
Vector backbone:
pLX304
Bacterial Resistance:
Ampicillin
Selection Marker:
Blasticidin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
V5 tag
Expression:
Transient,Stable
Sequencing Primer:
  • 3-1291
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3399569
$550.00
1 vial
Will be delivered in 6 to 8 Business Days
  • <
  • 1
  • ...
  • ...
  • ...
  • ...