You are viewing an incomplete version of our website. Please click to reload the website as full version.

Expression-ready ORF Clones

An open reading frame (ORF) is the region of a nucleotide sequence from a start codon to stop codon. In case of eukaryotic ORFs this might also include introns. In practical terms however, an ORF corresponds to the coding sequence (CDS) constituted by concatenated exons that is actually translated to from a protein. Free of any regulatory sequences and with both the 5’ and 3’ UTR removed, our ORF clones provide a shortcut to protein expression or subcloning.
437,354 Products
Data Quality
  • 1
  • 437354
  • 997
  • 197
  • 170
  • 161
  • 139
  • 294511
  • 64807
  • 60176
  • 5988
  • 3338
  • 785884
  • 437354
  • 365420
  • 154625
  • 114972
  • 298383
  • 93527
  • 45443
  • 1
Vector Backbone
  • 54421
  • 42128
  • 41851
  • 33867
  • 30289
Fusion tag
  • 60849
  • 96574
  • 75718
  • 59918
  • 29190
Resistance Gene
  • 229258
  • 89200
  • 83979
  • 34917
Selectable Marker
  • 179802
  • 64102
  • 9548
  • 202502
  • 189408
Expression Type
  • 202703
  • 189186
  • 64303
  • 422241
  • 15113
Supplier: Log in to see

Lentiviral Vector with ORF clone of Human GABA(A) receptor-associated protein (GABARAP) , C-term Myc-DDK-tagged

Protein Expression
GABA(A) Receptor-Associated Protein
NCBI Accession:
NM_007278, NP_009209
GABARAP, AaeL_AAEL007162, Gabarap, gabarapa
Insert length:
354 bp
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:
10 μg of lyophilized plasmid
4 °C/-20 °C
Catalog No. ABIN5393480
10 μg
Plus shipping costs $45.00 Will be delivered in 8 to 10 Business Days
Supplier: Log in to see

Lentiviral Vector with ORF clone of Human BCL2-like 1 (BCL2L1) transcript variant 1 , C-term Myc-DDK-tagged

Protein Expression
BCL2-Like 1
NCBI Accession:
NM_138578, NP_612815
bcl2l1, BCL2L1, LOC100224900, Tg(BCL2L1)2Cbt, Bcl2l1
Insert length:
702 bp
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:
10 μg of lyophilized plasmid
4 °C/-20 °C
Catalog No. ABIN5393934
10 μg
Plus shipping costs $45.00 Will be delivered in 8 to 10 Business Days
Supplier: Log in to see

Lentiviral Vector with ORF clone of Human BCL2-like 1 (BCL2L1) transcript variant 2 , C-term Myc-DDK-tagged

Protein Expression
BCL2-Like 1
NCBI Accession:
NM_001191, NP_001182
bcl2l1, BCL2L1, LOC100224900, Tg(BCL2L1)2Cbt, Bcl2l1
Insert length:
513 bp
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:
10 μg of lyophilized plasmid
4 °C/-20 °C
Catalog No. ABIN5393935
10 μg
Plus shipping costs $45.00 Will be delivered in 8 to 10 Business Days
Supplier: Log in to see

Lentiviral Vector with ORF clone of Human NAD(P)H dehydrogenase, quinone 1 (NQO1) transcript variant 3 , C-term Myc-DDK-tagged

Protein Expression
NAD(P)H Dehydrogenase, Quinone 1
NCBI Accession:
NM_001025434, NP_001020605
nqo1, NQO1, Bpet2092, Nqo1
Insert length:
711 bp
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:
10 μg of lyophilized plasmid
4 °C/-20 °C
Catalog No. ABIN5452576
10 μg
Plus shipping costs $45.00 Will be delivered in 21 Business Days
Supplier: Log in to see

Lentiviral Vector with ORF clone of Human NAD(P)H dehydrogenase, quinone 1 (NQO1) transcript variant 2, C-term Myc-DDK-tagged

Protein Expression
NAD(P)H Dehydrogenase, Quinone 1
NCBI Accession:
NM_001025433, NP_001020604
nqo1, NQO1, Bpet2092, Nqo1
Insert length:
723 bp
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:
10 μg of lyophilized plasmid
4 °C/-20 °C
Catalog No. ABIN5452577
10 μg
Plus shipping costs $45.00 Will be delivered in 11 Business Days
Supplier: Log in to see

Lentiviral Vector with ORF clone of Human GABA(A) receptor-associated protein (GABARAP) , C-term GFP tagged

Protein Expression
GABA(A) Receptor-Associated Protein
NCBI Accession:
NM_007278, NP_009209
GABARAP, AaeL_AAEL007162, Gabarap, gabarapa
Insert length:
354 bp
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:
GFP tag
10 μg of lyophilized plasmid
4 °C/-20 °C
Catalog No. ABIN5393478
10 μg
Plus shipping costs $45.00 Will be delivered in 21 Business Days
Supplier: Log in to see

Lentiviral Vector with ORF clone of Human BCL2-like 1 (BCL2L1) transcript variant 1, C-term GFP tagged

Protein Expression
BCL2-Like 1
NCBI Accession:
NM_138578, NP_612815
bcl2l1, BCL2L1, LOC100224900, Tg(BCL2L1)2Cbt, Bcl2l1
Insert length:
702 bp
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:
GFP tag
10 μg of lyophilized plasmid
4 °C/-20 °C
Catalog No. ABIN5393929
10 μg
Plus shipping costs $45.00 Will be delivered in 21 Business Days
Supplier: Log in to see

Lentiviral Vector with ORF clone of Human BCL2-like 1 (BCL2L1) transcript variant 2, C-term GFP tagged

Protein Expression
BCL2-Like 1
NCBI Accession:
NM_001191, NP_001182
bcl2l1, BCL2L1, LOC100224900, Tg(BCL2L1)2Cbt, Bcl2l1
Insert length:
513 bp
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:
GFP tag
10 μg of lyophilized plasmid
4 °C/-20 °C
Catalog No. ABIN5393930
10 μg
Plus shipping costs $45.00 Will be delivered in 21 Business Days
Supplier: Log in to see

Lentiviral Vector with ORF clone of Human NAD(P)H dehydrogenase, quinone 1 (NQO1) transcript variant 3, C-term GFP tagged

Protein Expression
NAD(P)H Dehydrogenase, Quinone 1
NCBI Accession:
NM_001025434, NP_001020605
nqo1, NQO1, Bpet2092, Nqo1
Insert length:
711 bp
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:
GFP tag
10 μg of lyophilized plasmid
4 °C/-20 °C
Catalog No. ABIN5452572
10 μg
Plus shipping costs $45.00 Will be delivered in 21 Business Days
Supplier: Log in to see

Lentiviral Vector with ORF clone of Human NAD(P)H dehydrogenase, quinone 1 (NQO1) transcript variant 2, C-term GFP tagged

Protein Expression
NAD(P)H Dehydrogenase, Quinone 1
NCBI Accession:
NM_001025433, NP_001020604
nqo1, NQO1, Bpet2092, Nqo1
Insert length:
723 bp
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:
GFP tag
10 μg of lyophilized plasmid
4 °C/-20 °C
Catalog No. ABIN5452573
10 μg
Plus shipping costs $45.00 Will be delivered in 11 Business Days
Supplier: Log in to see

Lentiviral Vector with ORF clone of Human NAD(P)H dehydrogenase, quinone 1 (NQO1) transcript variant 1 , C-term Myc-DDK-tagged

Protein Expression
NAD(P)H Dehydrogenase, Quinone 1
NCBI Accession:
NM_000903, NP_000894
nqo1, NQO1, Bpet2092, Nqo1
Insert length:
825 bp
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:
10 μg of lyophilized plasmid
4 °C/-20 °C
Catalog No. ABIN5452575
10 μg
Plus shipping costs $45.00 Will be delivered in 8 to 10 Business Days
Supplier: Log in to see

Lentiviral Vector with ORF clone of Human NAD(P)H dehydrogenase, quinone 1 (NQO1) transcript variant 1, C-term GFP tagged

Protein Expression
NAD(P)H Dehydrogenase, Quinone 1
NCBI Accession:
NM_000903, NP_000894
nqo1, NQO1, Bpet2092, Nqo1
Insert length:
825 bp
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:
GFP tag
10 μg of lyophilized plasmid
4 °C/-20 °C
Catalog No. ABIN5452571
10 μg
Plus shipping costs $45.00 Will be delivered in 21 Business Days
Supplier: Log in to see

Lentiviral Vector with ORF clone of Human alpha-fetoprotein (AFP) , C-term Myc-DDK-tagged

Protein Expression
NCBI Accession:
NM_001134, NP_001125
AFP, Afp
Insert length:
1830 bp
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:
10 μg of lyophilized plasmid
4 °C/-20 °C
Catalog No. ABIN5376584
10 μg
Plus shipping costs $45.00 Will be delivered in 8 to 10 Business Days
Supplier: Log in to see

Lentiviral Vector with ORF clone of Human T-box 19 (TBX19) , C-term Myc-DDK-tagged

Protein Expression
T-Box 19
NCBI Accession:
NM_005149, NP_005140
TBX19, LOC100352422, Tbx19
Insert length:
1347 bp
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:
10 μg of lyophilized plasmid
4 °C/-20 °C
Catalog No. ABIN5408567
10 μg
Plus shipping costs $45.00 Will be delivered in 21 Business Days
Supplier: Log in to see

Lentiviral Vector with ORF clone of Human alpha-fetoprotein (AFP) , C-term GFP tagged

Protein Expression
NCBI Accession:
NM_001134, NP_001125
AFP, Afp
Insert length:
1830 bp
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:
GFP tag
10 μg of lyophilized plasmid
4 °C/-20 °C
Catalog No. ABIN5376582
10 μg
Plus shipping costs $45.00 Will be delivered in 21 Business Days
Supplier: Log in to see

Lentiviral Vector with ORF clone of Human T-box 19 (TBX19) , C-term GFP tagged

Protein Expression
T-Box 19
NCBI Accession:
NM_005149, NP_005140
TBX19, LOC100352422, Tbx19
Insert length:
1347 bp
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:
GFP tag
10 μg of lyophilized plasmid
4 °C/-20 °C
Catalog No. ABIN5408565
10 μg
Plus shipping costs $45.00 Will be delivered in 21 Business Days
Supplier: Log in to see

Mammalian Vector with ORF clone of Human BCL2-like 1 (BCL2L1) transcript variant 1

Protein Expression
BCL2-Like 1
NCBI Accession:
NM_138578, NP_612815
bcl2l1, BCL2L1, LOC100224900, Tg(BCL2L1)2Cbt, Bcl2l1
Insert length:
702 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5393923
10 μg
Plus shipping costs $45.00 Will be delivered in 8 to 10 Business Days
Supplier: Log in to see

Mammalian Vector with ORF clone of Human BCL2-like 1 (BCL2L1) transcript variant 2

Protein Expression
BCL2-Like 1
NCBI Accession:
NM_001191, NP_001182
bcl2l1, BCL2L1, LOC100224900, Tg(BCL2L1)2Cbt, Bcl2l1
Insert length:
513 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5393924
10 μg
Plus shipping costs $45.00 Will be delivered in 8 to 10 Business Days
Supplier: Log in to see

Lentiviral Vector with ORF clone of Human growth hormone receptor (GHR) , C-term Myc-DDK-tagged

Protein Expression
Growth Hormone Receptor
NCBI Accession:
NM_000163, NP_000154
ghr, GHR, LOC100304685, BLVRB, Ghr
Insert length:
1917 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5350683
10 μg
Plus shipping costs $45.00 Will be delivered in 16 Business Days
Supplier: Log in to see

Mammalian Vector with ORF clone of Human NAD(P)H dehydrogenase, quinone 1 (NQO1) transcript variant 1

Protein Expression
NAD(P)H Dehydrogenase, Quinone 1
NCBI Accession:
NM_000903, NP_000894
nqo1, NQO1, Bpet2092, Nqo1
Insert length:
825 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5452566
10 μg
Plus shipping costs $45.00 Will be delivered in 8 to 10 Business Days
  • <
  • 1
  • ...
  • ...
  • ...
  • ...
  • ...