Expression-ready ORF Clones

An open reading frame (ORF) is the region of a nucleotide sequence from a start codon to stop codon. In case of eukaryotic ORFs this might also include introns. In practical terms however, an ORF corresponds to the coding sequence (CDS) constituted by concatenated exons that is actually translated to from a protein. Free of any regulatory sequences and with both the 5’ and 3’ UTR removed, our ORF clones provide a shortcut to protein expression or subcloning.
397,475 Products
Data Quality
  • 1
Type
  • 397475
    Plasmid
Gene
  • 997
  • 192
  • 167
  • 161
  • 134
Species
  • 256615
  • 62856
  • 60176
  • 5988
  • 3338
Insert
  • 585860
  • 397475
    ORF
  • 215849
  • 154617
  • 114972
Vector
  • 298383
  • 83979
  • 15112
  • 1
Vector Backbone
  • 54421
  • 42128
  • 41851
  • 33867
  • 30210
Fusion tag
  • 30518
  • 96574
  • 75718
  • 59918
  • 29190
Resistance Gene
  • 218732
  • 83979
  • 79652
  • 15112
Selectable Marker
  • 179802
  • 64102
Promoter
  • 202502
  • 179860
Expression Type
  • 202690
  • 179651
  • 64290
Application
  • 382362
  • 15113
Supplier: Log in to see

Lentiviral Vector with ORF clone of Human BCL2-like 1 (BCL2L1) transcript variant 1 , C-term Myc-DDK-tagged

Type:
ORF
Application:
Protein Expression
Gene:
BCL2-Like 1 (BCL2L1)
NCBI Accession:
NM_138578,NP_612815
Species:
Human
Synonyms:
bcl2l1, BCL2L1, LOC100224900, Tg(BCL2L1)2Cbt, Bcl2l1
Insert length:
702 bp
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-C-Myc-DDK
Resistance Gene:
Chloramphenicol
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Components:
10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5393934
$640.00
10 μg
Plus shipping costs $45.00 Will be delivered in 8 to 10 Business Days
Supplier: Log in to see

Lentiviral Vector with ORF clone of Human BCL2-like 1 (BCL2L1) transcript variant 2 , C-term Myc-DDK-tagged

Type:
ORF
Application:
Protein Expression
Gene:
BCL2-Like 1 (BCL2L1)
NCBI Accession:
NM_001191,NP_001182
Species:
Human
Synonyms:
bcl2l1, BCL2L1, LOC100224900, Tg(BCL2L1)2Cbt, Bcl2l1
Insert length:
513 bp
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-C-Myc-DDK
Resistance Gene:
Chloramphenicol
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Components:
10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5393935
$640.00
10 μg
Plus shipping costs $45.00 Will be delivered in 8 to 10 Business Days
Supplier: Log in to see

Lentiviral Vector with ORF clone of Human GABA(A) receptor-associated protein (GABARAP) , C-term Myc-DDK-tagged

Type:
ORF
Application:
Protein Expression
Gene:
GABA(A) Receptor-Associated Protein (GABARAP)
NCBI Accession:
NM_007278,NP_009209
Species:
Human
Synonyms:
GABARAP, AaeL_AAEL007162, Gabarap, gabarapa
Insert length:
354 bp
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-C-Myc-DDK
Resistance Gene:
Chloramphenicol
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Components:
10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5393480
$640.00
10 μg
Plus shipping costs $45.00 Will be delivered in 8 to 10 Business Days
Supplier: Log in to see

Lentiviral Vector with ORF clone of Human NAD(P)H dehydrogenase, quinone 1 (NQO1) transcript variant 2, C-term Myc-DDK-tagged

Type:
ORF
Application:
Protein Expression
Gene:
NAD(P)H Dehydrogenase, Quinone 1 (NQO1)
NCBI Accession:
NM_001025433,NP_001020604
Species:
Human
Synonyms:
nqo1, NQO1, Bpet2092, Nqo1
Insert length:
723 bp
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-C-Myc-DDK
Resistance Gene:
Chloramphenicol
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Components:
10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5452577
$640.00
10 μg
Plus shipping costs $45.00 Will be delivered in 11 Business Days
Supplier: Log in to see

Lentiviral Vector with ORF clone of Human NAD(P)H dehydrogenase, quinone 1 (NQO1) transcript variant 3 , C-term Myc-DDK-tagged

Type:
ORF
Application:
Protein Expression
Gene:
NAD(P)H Dehydrogenase, Quinone 1 (NQO1)
NCBI Accession:
NM_001025434,NP_001020605
Species:
Human
Synonyms:
nqo1, NQO1, Bpet2092, Nqo1
Insert length:
711 bp
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-C-Myc-DDK
Resistance Gene:
Chloramphenicol
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Components:
10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5452576
$640.00
10 μg
Plus shipping costs $45.00 Will be delivered in 21 Business Days
Supplier: Log in to see

Lentiviral Vector with ORF clone of Human BCL2-like 1 (BCL2L1) transcript variant 1, C-term GFP tagged

Type:
ORF
Application:
Protein Expression
Gene:
BCL2-Like 1 (BCL2L1)
NCBI Accession:
NM_138578,NP_612815
Species:
Human
Synonyms:
bcl2l1, BCL2L1, LOC100224900, Tg(BCL2L1)2Cbt, Bcl2l1
Insert length:
702 bp
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-C-mGFP
Resistance Gene:
Chloramphenicol
Promoter:
CMV Promoter
Fusion Tag:
GFP tag
Expression:
Transient
Components:
10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5393929
$700.00
10 μg
Plus shipping costs $45.00 Will be delivered in 21 Business Days
Supplier: Log in to see

Lentiviral Vector with ORF clone of Human BCL2-like 1 (BCL2L1) transcript variant 2, C-term GFP tagged

Type:
ORF
Application:
Protein Expression
Gene:
BCL2-Like 1 (BCL2L1)
NCBI Accession:
NM_001191,NP_001182
Species:
Human
Synonyms:
bcl2l1, BCL2L1, LOC100224900, Tg(BCL2L1)2Cbt, Bcl2l1
Insert length:
513 bp
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-C-mGFP
Resistance Gene:
Chloramphenicol
Promoter:
CMV Promoter
Fusion Tag:
GFP tag
Expression:
Transient
Components:
10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5393930
$700.00
10 μg
Plus shipping costs $45.00 Will be delivered in 21 Business Days
Supplier: Log in to see

Lentiviral Vector with ORF clone of Human GABA(A) receptor-associated protein (GABARAP) , C-term GFP tagged

Type:
ORF
Application:
Protein Expression
Gene:
GABA(A) Receptor-Associated Protein (GABARAP)
NCBI Accession:
NM_007278,NP_009209
Species:
Human
Synonyms:
GABARAP, AaeL_AAEL007162, Gabarap, gabarapa
Insert length:
354 bp
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-C-mGFP
Resistance Gene:
Chloramphenicol
Promoter:
CMV Promoter
Fusion Tag:
GFP tag
Expression:
Transient
Components:
10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5393478
$700.00
10 μg
Plus shipping costs $45.00 Will be delivered in 21 Business Days
Supplier: Log in to see

Lentiviral Vector with ORF clone of Human NAD(P)H dehydrogenase, quinone 1 (NQO1) transcript variant 3, C-term GFP tagged

Type:
ORF
Application:
Protein Expression
Gene:
NAD(P)H Dehydrogenase, Quinone 1 (NQO1)
NCBI Accession:
NM_001025434,NP_001020605
Species:
Human
Synonyms:
nqo1, NQO1, Bpet2092, Nqo1
Insert length:
711 bp
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-C-mGFP
Resistance Gene:
Chloramphenicol
Promoter:
CMV Promoter
Fusion Tag:
GFP tag
Expression:
Transient
Components:
10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5452572
$700.00
10 μg
Plus shipping costs $45.00 Will be delivered in 21 Business Days
Supplier: Log in to see

Lentiviral Vector with ORF clone of Human NAD(P)H dehydrogenase, quinone 1 (NQO1) transcript variant 2, C-term GFP tagged

Type:
ORF
Application:
Protein Expression
Gene:
NAD(P)H Dehydrogenase, Quinone 1 (NQO1)
NCBI Accession:
NM_001025433,NP_001020604
Species:
Human
Synonyms:
nqo1, NQO1, Bpet2092, Nqo1
Insert length:
723 bp
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-C-mGFP
Resistance Gene:
Chloramphenicol
Promoter:
CMV Promoter
Fusion Tag:
GFP tag
Expression:
Transient
Components:
10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5452573
$700.00
10 μg
Plus shipping costs $45.00 Will be delivered in 11 Business Days
Supplier: Log in to see

Lentiviral Vector with ORF clone of Human NAD(P)H dehydrogenase, quinone 1 (NQO1) transcript variant 1 , C-term Myc-DDK-tagged

Type:
ORF
Application:
Protein Expression
Gene:
NAD(P)H Dehydrogenase, Quinone 1 (NQO1)
NCBI Accession:
NM_000903,NP_000894
Species:
Human
Synonyms:
nqo1, NQO1, Bpet2092, Nqo1
Insert length:
825 bp
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-C-Myc-DDK
Resistance Gene:
Chloramphenicol
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Components:
10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5452575
$720.00
10 μg
Plus shipping costs $45.00 Will be delivered in 8 to 10 Business Days
Supplier: Log in to see

Lentiviral Vector with ORF clone of Human NAD(P)H dehydrogenase, quinone 1 (NQO1) transcript variant 1, C-term GFP tagged

Type:
ORF
Application:
Protein Expression
Gene:
NAD(P)H Dehydrogenase, Quinone 1 (NQO1)
NCBI Accession:
NM_000903,NP_000894
Species:
Human
Synonyms:
nqo1, NQO1, Bpet2092, Nqo1
Insert length:
825 bp
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-C-mGFP
Resistance Gene:
Chloramphenicol
Promoter:
CMV Promoter
Fusion Tag:
GFP tag
Expression:
Transient
Components:
10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5452571
$780.00
10 μg
Plus shipping costs $45.00 Will be delivered in 21 Business Days
Supplier: Log in to see

Lentiviral Vector with ORF clone of Human alpha-fetoprotein (AFP) , C-term Myc-DDK-tagged

Type:
ORF
Application:
Protein Expression
Gene:
alpha-Fetoprotein (AFP)
NCBI Accession:
NM_001134,NP_001125
Species:
Human
Synonyms:
AFP, Afp
Insert length:
1830 bp
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-C-Myc-DDK
Resistance Gene:
Chloramphenicol
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Components:
10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5376584
$800.00
10 μg
Plus shipping costs $45.00 Will be delivered in 8 to 10 Business Days
Supplier: Log in to see

Lentiviral Vector with ORF clone of Human T-box 19 (TBX19) , C-term Myc-DDK-tagged

Type:
ORF
Application:
Protein Expression
Gene:
T-Box 19 (TBX19)
NCBI Accession:
NM_005149,NP_005140
Species:
Human
Synonyms:
TBX19, LOC100352422, Tbx19
Insert length:
1347 bp
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-C-Myc-DDK
Resistance Gene:
Chloramphenicol
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Components:
10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5408567
$800.00
10 μg
Plus shipping costs $45.00 Will be delivered in 21 Business Days
Supplier: Log in to see

Lentiviral Vector with ORF clone of Human alpha-fetoprotein (AFP) , C-term GFP tagged

Type:
ORF
Application:
Protein Expression
Gene:
alpha-Fetoprotein (AFP)
NCBI Accession:
NM_001134,NP_001125
Species:
Human
Synonyms:
AFP, Afp
Insert length:
1830 bp
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-C-mGFP
Resistance Gene:
Chloramphenicol
Promoter:
CMV Promoter
Fusion Tag:
GFP tag
Expression:
Transient
Components:
10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5376582
$870.00
10 μg
Plus shipping costs $45.00 Will be delivered in 21 Business Days
Supplier: Log in to see

Lentiviral Vector with ORF clone of Human T-box 19 (TBX19) , C-term GFP tagged

Type:
ORF
Application:
Protein Expression
Gene:
T-Box 19 (TBX19)
NCBI Accession:
NM_005149,NP_005140
Species:
Human
Synonyms:
TBX19, LOC100352422, Tbx19
Insert length:
1347 bp
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-C-mGFP
Resistance Gene:
Chloramphenicol
Promoter:
CMV Promoter
Fusion Tag:
GFP tag
Expression:
Transient
Components:
10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5408565
$870.00
10 μg
Plus shipping costs $45.00 Will be delivered in 21 Business Days
Supplier: Log in to see

Lentiviral Vector with ORF clone of Human growth hormone receptor (GHR) , C-term Myc-DDK-tagged

Type:
ORF
Application:
Protein Expression
Gene:
Growth Hormone Receptor (GHR)
NCBI Accession:
NM_000163,NP_000154
Species:
Human
Synonyms:
ghr, GHR, LOC100304685, BLVRB, Ghr
Insert length:
1917 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC-Myc-DDK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Stable, Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5350683
$158.00
10 μg
Plus shipping costs $45.00 Will be delivered in 16 Business Days
Supplier: Log in to see

Mammalian Vector with ORF clone of Human BCL2-like 1 (BCL2L1) transcript variant 1

Type:
ORF
Application:
Protein Expression
Gene:
BCL2-Like 1 (BCL2L1)
NCBI Accession:
NM_138578,NP_612815
Species:
Human
Synonyms:
bcl2l1, BCL2L1, LOC100224900, Tg(BCL2L1)2Cbt, Bcl2l1
Insert length:
702 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5393923
$158.00
10 μg
Plus shipping costs $45.00 Will be delivered in 8 to 10 Business Days
Supplier: Log in to see

Mammalian Vector with ORF clone of Human BCL2-like 1 (BCL2L1) transcript variant 2

Type:
ORF
Application:
Protein Expression
Gene:
BCL2-Like 1 (BCL2L1)
NCBI Accession:
NM_001191,NP_001182
Species:
Human
Synonyms:
bcl2l1, BCL2L1, LOC100224900, Tg(BCL2L1)2Cbt, Bcl2l1
Insert length:
513 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5393924
$158.00
10 μg
Plus shipping costs $45.00 Will be delivered in 8 to 10 Business Days
Supplier: Log in to see

Mammalian Vector with ORF clone of Human NAD(P)H dehydrogenase, quinone 1 (NQO1) transcript variant 1

Type:
ORF
Application:
Protein Expression
Gene:
NAD(P)H Dehydrogenase, Quinone 1 (NQO1)
NCBI Accession:
NM_000903,NP_000894
Species:
Human
Synonyms:
nqo1, NQO1, Bpet2092, Nqo1
Insert length:
825 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5452566
$158.00
10 μg
Plus shipping costs $45.00 Will be delivered in 8 to 10 Business Days
  • <
  • 1
  • ...
  • ...
  • ...
  • ...
  • ...