A1CF (APOBEC1 Complementation Factor, A1CF)

Short Description: Mammalian apolipoprotein B mRNA undergoes site-specific C to U deamination, which is mediated by a multi-component enzyme complex containing a minimal core composed of APOBEC-1 and a complementation factor encoded by this gene. The gene product has three non-identical RNA recognition motifs and belongs to the hnRNP R family of RNA-binding proteins. It has been proposed that this complementation factor functions as an RNA-binding subunit and docks APOBEC-1 to deaminate the upstream cytidine. Studies suggest that the protein may also be involved in other RNA editing or RNA processing events. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Nov 2010].
More information related to gene A1CF.
Products related to A1CF Gene:
133 Products
  • 127
  • 6
  • 73
  • 30
  • 28
  • 2
  • 74
  • 30
  • 27
  • 16
Fusion tag
  • 41
  • 25
  • 19
  • 12
  • 8
Vector Backbone
  • 11
  • 10
  • 10
  • 6
  • 6
  • 45
  • 44
  • 16
  • 10
  • 9
  • 45
  • 45
  • 21
  • 8
  • 6
  • 6
Resistance Gene
  • 51
  • 43
  • 26
  • 7
  • 2
Expression Type
  • 118
  • 62
Selectable Marker
  • 43
  • 26
  • 1
  • 56
  • 31
  • 17
  • 10
  • 8
  • 59
  • 36
  • 24
  • 14
Supplier: Log in to see

ORF Cloning-Vector holds the gene between an AflII and EcoRV cut site.

APOBEC1 Complementation Factor (A1CF)
A1CF, A1cf, a1cf, a1cf.L
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5732982
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Full length Mus musculus APOBEC1 complementation factor cDNA clone.

APOBEC1 Complementation Factor (A1CF)
Gene ID:
69865 (Mouse (Murine), A1CF)
A1CF, A1cf, a1cf, a1cf.L
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Glycerol Stock
-80 °C
Catalog No. ABIN4045040
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Homo sapiens APOBEC1 complementation factor cDNA clone.

APOBEC1 Complementation Factor (A1CF)
Gene ID:
29974 (Human, A1CF)
A1CF, A1cf, a1cf, a1cf.L
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4005075
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Homo sapiens APOBEC1 complementation factor cDNA clone.

APOBEC1 Complementation Factor (A1CF)
Gene ID:
29974 (Human, A1CF)
A1CF, A1cf, a1cf, a1cf.L
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4005076
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Xenopus laevis APOBEC1 complementation factor cDNA clone.

Protein Expression, Cloning
APOBEC1 Complementation Factor (A1CF)
Gene ID:
444478 (Xenopus laevis, A1CF)
A1CF, A1cf, a1cf, a1cf.L
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3850517
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Mus musculus APOBEC1 complementation factor cDNA clone.

APOBEC1 Complementation Factor (A1CF)
Gene ID:
69865 (Mouse (Murine), A1CF)
A1CF, A1cf, a1cf, a1cf.L
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Glycerol Stock
-80 °C
Catalog No. ABIN4045039
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens APOBEC1 complementation factor cDNA clone.

APOBEC1 Complementation Factor (A1CF)
Gene ID:
29974 (Human, A1CF)
A1CF, A1cf, a1cf, a1cf.L
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4005077
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens APOBEC1 complementation factor cDNA clone.

APOBEC1 Complementation Factor (A1CF)
Gene ID:
29974 (Human, A1CF)
A1CF, A1cf, a1cf, a1cf.L
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4005078
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Xenopus laevis APOBEC1 complementation factor cDNA clone.

Protein Expression, Cloning
APOBEC1 Complementation Factor (A1CF)
Gene ID:
444478 (Xenopus laevis, A1CF)
A1CF, A1cf, a1cf, a1cf.L
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3850516
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Entry clone of human cDNA (ORF) without STOP codon in Gateway pDONR223 Vector.

APOBEC1 Complementation Factor (A1CF)
Gene ID:
29974 (Human, A1CF)
A1CF, A1cf, a1cf, a1cf.L
Insert length:
369 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
2 μg of lyophilized gene in pDONR223 vector
-20 °C
Catalog No. ABIN5322424
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
Supplier: Log in to see

Entry clone of human cDNA (ORF) without STOP codon in Gateway pDONR223 Vector.

APOBEC1 Complementation Factor (A1CF)
Gene ID:
29974 (Human, A1CF)
A1CF, A1cf, a1cf, a1cf.L
Insert length:
1785 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
2 μg of lyophilized gene in pDONR223 vector
-20 °C
Catalog No. ABIN5324670
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
Supplier: Log in to see

Bacterial expression of Human A1CF with His tag

APOBEC1 Complementation Factor (A1CF)
A1CF, A1cf, a1cf, a1cf.L
Insert length:
369 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4372090
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Mammalian expression of Human A1CF with HA tag

Protein Expression
APOBEC1 Complementation Factor (A1CF)
A1CF, A1cf, a1cf, a1cf.L
Insert length:
369 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
HA tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4372521
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Mammalian expression of Human A1CF with His tag

Protein Expression
APOBEC1 Complementation Factor (A1CF)
A1CF, A1cf, a1cf, a1cf.L
Insert length:
369 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
His tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4432718
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Human A1CF with His-GST

APOBEC1 Complementation Factor (A1CF)
A1CF, A1cf, a1cf, a1cf.L
Insert length:
369 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4825875
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Human A1CF with His tag

APOBEC1 Complementation Factor (A1CF)
A1CF, A1cf, a1cf, a1cf.L
Insert length:
369 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4757998
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Human A1CF with His-MBP

APOBEC1 Complementation Factor (A1CF)
A1CF, A1cf, a1cf, a1cf.L
Insert length:
369 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4696746
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

The APOBEC1 complementation factor ORF clone is provided in a Gateway adapted entry vector for fast and convenient transfer to any compatible expression vector.

Protein Expression
APOBEC1 Complementation Factor (A1CF)
Gene ID:
29974 (Human, A1CF)
A1CF, A1cf, a1cf, a1cf.L
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3412715
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

ORF Cloning-Vector holds the gene between an AflII and EcoRV cut site.

APOBEC1 Complementation Factor (A1CF)
A1CF, A1cf, a1cf, a1cf.L
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5732983
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Mammalian Vector with ORF clone of Human APOBEC1 complementation factor (A1CF) transcript variant 1

Protein Expression
APOBEC1 Complementation Factor (A1CF)
NCBI Accession:
A1CF, A1cf, a1cf, a1cf.L
Insert length:
1761 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5376963
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
  • <
  • 1

Synonyms and alternative names related to A1CF

  • APOBEC1 complementation factor (A1CF)
  • APOBEC1 complementation factor (A1cf)
  • apobec1 complementation factor (a1cf)
  • APOBEC1 complementation factor L homeolog (a1cf.L)
  • APOBEC1 complementation factor (a1cf)
  • 1810073H04Rik
  • A1CF
  • A1cft
  • ACF
  • Acf
  • acf
  • ACF64
  • acf64
  • ACF65
  • acf65
  • Apobec-1
  • apobec1cf
  • ASP
  • asp

Gene-IDs for different species

29974 Homo sapiens
69865 Mus musculus
170912 Rattus norvegicus
423680 Gallus gallus
477581 Canis lupus familiaris
562916 Danio rerio
100174508 Pongo abelii
100339264 Oryctolagus cuniculus
444478 Xenopus laevis
703806 Macaca mulatta
100493284 Xenopus (Silurana) tropicalis
100540486 Meleagris gallopavo
100553455 Anolis carolinensis
100600191 Nomascus leucogenys
100336715 Bos taurus
100155074 Sus scrofa
100730935 Cavia porcellus
101118147 Ovis aries

Protein level used designations for A1CF

  • APOBEC-1 stimulating protein
  • apo-B RNA editing protein
  • apobec-1 complementation factor (ACF) (ASP)
  • APOBEC1-stimulating protein
  • apobec-1 complementation factor
  • APOBEC1 complementation factort
  • Apobec-1 complementation factor APOBEC-1 stimulating protein
  • Apobec-1 complementation factor, APOBEC-1 stimulating protein
  • acf
  • APOBEC1 complementation factor
Other products related to A1CF such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com