A4GNT (alpha-1,4-N-Acetylglucosaminyltransferase, A4GNT)

Short Description: Necessary for the synthesis of type III mucin. Catalyzes the transfer of N-acetylglucosamine (GlcNAc) to core 2 branched O- glycans.
More information related to gene A4GNT.
Products related to A4GNT Gene:
85 Products
Type
  • 81
  • 4
Species
  • 52
  • 29
  • 2
  • 2
Application
  • 42
  • 22
  • 16
  • 12
  • 1
Fusion tag
  • 32
  • 10
  • 8
  • 7
  • 6
Vector Backbone
  • 8
  • 4
  • 4
  • 4
  • 4
Vector
  • 27
  • 25
  • 12
  • 8
  • 6
Insert
  • 31
  • 25
  • 13
  • 6
  • 4
Oligo-Type
  • 3
  • 1
Resistance Gene
  • 40
  • 25
  • 14
  • 2
  • 2
Expression Type
  • 55
  • 34
  • 11
Selectable Marker
  • 19
  • 18
  • 11
  • 8
  • 1
Promoter
  • 21
  • 20
  • 16
  • 8
  • 6
Format
  • 37
  • 17
  • 16
  • 15
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT)
Gene ID:
51146 (Human, A4GNT)
Synonyms:
A4GNT, a4gnt, a4gnt.L, A4gnt
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3989431
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT)
Gene ID:
51146 (Human, A4GNT)
Synonyms:
A4GNT, a4gnt, a4gnt.L, A4gnt
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3989432
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT)
Gene ID:
734685 (Xenopus laevis, A4GNT)
Synonyms:
A4GNT, a4gnt, a4gnt.L, A4gnt
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4044395
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT)
Gene ID:
333424 (Mouse (Murine), A4GNT)
Synonyms:
A4GNT, a4gnt, a4gnt.L, A4gnt
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3995219
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT)
Gene ID:
549416 (Xenopus tropicalis, A4GNT)
Synonyms:
A4GNT, a4gnt, a4gnt.L, A4gnt
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4022442
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT)
Gene ID:
333424 (Mouse (Murine), A4GNT)
Synonyms:
A4GNT, a4gnt, a4gnt.L, A4gnt
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3995220
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT)
Species:
Human
Synonyms:
A4GNT, a4gnt, a4gnt.L, A4gnt
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3545822
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Application:
Quantitative real-time PCR
Gene:
alpha-1,4-N-Acetylglucosaminyltransferase
Species:
Human
Synonyms:
A4GNT, a4gnt, MGC116495, ALPHA4GNT, alpha4GnT, AV080780, Alpha4gnt, Gm798
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3192763
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT)
Gene ID:
51146 (Human, A4GNT)
Synonyms:
A4GNT, a4gnt, a4gnt.L, A4gnt
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3989429
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT)
Gene ID:
51146 (Human, A4GNT)
Synonyms:
A4GNT, a4gnt, a4gnt.L, A4gnt
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3989430
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT)
Gene ID:
549416 (Xenopus tropicalis, A4GNT)
Synonyms:
A4GNT, a4gnt, a4gnt.L, A4gnt
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4022443
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT)
Gene ID:
333424 (Mouse (Murine), A4GNT)
Synonyms:
A4GNT, a4gnt, a4gnt.L, A4gnt
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3995221
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT)
Gene ID:
333424 (Mouse (Murine), A4GNT)
Synonyms:
A4GNT, a4gnt, a4gnt.L, A4gnt
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3995222
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT)
Gene ID:
734685 (Xenopus laevis, A4GNT)
Synonyms:
A4GNT, a4gnt, a4gnt.L, A4gnt
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4044396
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Cloning
Gene:
alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT)
Gene ID:
51146 (Human, A4GNT)
Synonyms:
A4GNT, a4gnt, a4gnt.L, A4gnt
Insert length:
1023 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5325244
$194.53
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT)
Gene ID:
51146 (Human, A4GNT)
Synonyms:
A4GNT, a4gnt, a4gnt.L, A4gnt
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3414924
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT)
NCBI Accession:
NM_016161,NP_057245
Species:
Human
Synonyms:
A4GNT, a4gnt, a4gnt.L, A4gnt
Insert length:
1023 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5391261
$410.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see

Application:
RNA Interference
Gene:
alpha-1,4-N-Acetylglucosaminyltransferase
Species:
Mouse (Murine)
Synonyms:
A4GNT, a4gnt, MGC116495, ALPHA4GNT, alpha4GnT, AV080780, Alpha4gnt, Gm798
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • A4gnt (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3267570
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Application:
RNA Interference
Gene:
alpha-1,4-N-Acetylglucosaminyltransferase
Species:
Human
Synonyms:
A4GNT, a4gnt, MGC116495, ALPHA4GNT, alpha4GnT, AV080780, Alpha4gnt, Gm798
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • A4GNT (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3285610
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT)
NCBI Accession:
NM_001077424
Species:
Mouse (Murine)
Synonyms:
A4GNT, a4gnt, a4gnt.L, A4gnt
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of A4gnt
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5113214
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
  • <
  • 1

Synonyms and alternative names related to A4GNT

  • alpha-1,4-N-acetylglucosaminyltransferase (A4GNT)
  • alpha-1,4-N-acetylglucosaminyltransferase (a4gnt)
  • alpha-1,4-N-acetylglucosaminyltransferase L homeolog (a4gnt.L)
  • alpha-1,4-N-acetylglucosaminyltransferase (A4gnt)
  • A4GNT
  • a4gnt
  • ALPHA4GNT
  • alpha4GnT
  • Alpha4gnt
  • AV080780
  • Gm798
  • MGC116495

Gene-IDs for different species

GENE IDSPECIES
460724 Pan troglodytes
549416 Xenopus (Silurana) tropicalis
716512 Macaca mulatta
734685 Xenopus laevis
100033872 Equus caballus
100462185 Pongo abelii
51146 Homo sapiens
540795 Bos taurus
485683 Canis lupus familiaris
333424 Mus musculus
685758 Rattus norvegicus
429136 Gallus gallus

Protein level used designations for A4GNT

  • alpha-1,4-N-acetylglucosaminyltransferase
  • alpha 1,4-N-Acetylglucosaminyltransferase
  • alpha-1,4-N-acetylglucosaminyltransferase-like
Other products related to A4GNT such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com