A4GNT (alpha-1,4-N-Acetylglucosaminyltransferase, A4GNT)

Short Description: Necessary for the synthesis of type III mucin. Catalyzes the transfer of N-acetylglucosamine (GlcNAc) to core 2 branched O- glycans.
More information related to gene A4GNT.
Products related to A4GNT Gene:
  • 74
  • 3
  • 48
  • 27
  • 1
  • 1
  • 42
  • 16
  • 14
  • 12
  • 1
Fusion tag
  • 25
  • 9
  • 8
  • 7
  • 6
Vector Backbone
  • 4
  • 4
  • 4
  • 4
  • 4
  • 26
  • 25
  • 8
  • 6
  • 6
  • 25
  • 25
  • 12
  • 6
  • 4
  • 2
  • 1
Resistance Gene
  • 35
  • 24
  • 13
  • 2
  • 2
Expression Type
  • 54
  • 33
  • 11
Selectable Marker
  • 18
  • 17
  • 11
  • 4
  • 1
  • 20
  • 19
  • 16
  • 8
  • 6
  • 35
  • 16
  • 15
  • 11
77 Products

alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT)
A4GNT, a4gnt, a4gnt.L, A4gnt
Vector type:
TA-Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Catalog No. ABIN3545822
1 vial
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT)
Gene ID:
51146 (Human, A4GNT)
A4GNT, a4gnt, a4gnt.L, A4gnt
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3989429
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT)
Gene ID:
51146 (Human, A4GNT)
A4GNT, a4gnt, a4gnt.L, A4gnt
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3989430
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT)
Gene ID:
549416 (Xenopus tropicalis, A4GNT)
A4GNT, a4gnt, a4gnt.L, A4gnt
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4022443
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT)
Gene ID:
734685 (Xenopus laevis, A4GNT)
A4GNT, a4gnt, a4gnt.L, A4gnt
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • M13(-21)
Glycerol Stock
-80 °C
Catalog No. ABIN4044396
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT)
Gene ID:
333424 (Mouse, A4GNT)
A4GNT, a4gnt, a4gnt.L, A4gnt
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3995222
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT)
Gene ID:
333424 (Mouse, A4GNT)
A4GNT, a4gnt, a4gnt.L, A4gnt
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3995221
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Quantitative real-time PCR
A4GNT, a4gnt, MGC116495, ALPHA4GNT, alpha4GnT, AV080780, Alpha4gnt, Gm798
-20 °C
Catalog No. ABIN3192763
1 vial
Plus shipping costs $45.00
Delivery in 12 to 16 Business Days

alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT)
Gene ID:
51146 (Human, A4GNT)
A4GNT, a4gnt, a4gnt.L, A4gnt
Insert length:
1023 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
2 μg of lyophilized gene in pDONR223 vector
-20 °C
Catalog No. ABIN5325244
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Protein Expression
alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT)
Gene ID:
51146 (Human, A4GNT)
A4GNT, a4gnt, a4gnt.L, A4gnt
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3414924
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Genome Editing with Engineered Nucleases, Protein Expression
alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT)
NCBI Accession:
A4GNT, a4gnt, a4gnt.L, A4gnt
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of A4GNT
Viral Particles
-80 °C
Catalog No. ABIN5113212
300 μL
Plus shipping costs $45.00 and $24.00 dry ice

Genome Editing with Engineered Nucleases, Protein Expression
alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT)
NCBI Accession:
A4GNT, a4gnt, a4gnt.L, A4gnt
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of A4gnt
Viral Particles
-80 °C
Catalog No. ABIN5113214
300 μL
Plus shipping costs $45.00 and $24.00 dry ice

Protein Expression
alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT)
NCBI Accession:
A4GNT, a4gnt, a4gnt.L, A4gnt
Insert length:
1023 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5391261
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

RNA Interference
A4GNT, a4gnt, MGC116495, ALPHA4GNT, alpha4GnT, AV080780, Alpha4gnt, Gm798
HPLC purified
Available with shipment
  • A4gnt (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
-20 °C
Catalog No. ABIN3267570
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

RNA Interference
A4GNT, a4gnt, MGC116495, ALPHA4GNT, alpha4GnT, AV080780, Alpha4gnt, Gm798
HPLC purified
Available with shipment
  • A4GNT (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
-20 °C
Catalog No. ABIN3285610
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT)
A4GNT, a4gnt, a4gnt.L, A4gnt
Insert length:
1023 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4696753
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT)
A4GNT, a4gnt, a4gnt.L, A4gnt
Insert length:
1023 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4825882
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT)
A4GNT, a4gnt, a4gnt.L, A4gnt
Insert length:
1023 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4775385
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT)
A4GNT, a4gnt, a4gnt.L, A4gnt
Insert length:
1023 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4627164
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Protein Expression
alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT)
A4GNT, a4gnt, a4gnt.L, A4gnt
Insert length:
1023 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
HA tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4483693
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to A4GNT

  • alpha-1,4-N-acetylglucosaminyltransferase (A4GNT)
  • alpha-1,4-N-acetylglucosaminyltransferase (a4gnt)
  • alpha-1,4-N-acetylglucosaminyltransferase L homeolog (a4gnt.L)
  • alpha-1,4-N-acetylglucosaminyltransferase (A4gnt)
  • A4GNT
  • a4gnt
  • alpha4GnT
  • Alpha4gnt
  • AV080780
  • Gm798
  • MGC116495

Gene-IDs for different species

460724 Pan troglodytes
549416 Xenopus (Silurana) tropicalis
716512 Macaca mulatta
734685 Xenopus laevis
100033872 Equus caballus
100462185 Pongo abelii
51146 Homo sapiens
540795 Bos taurus
485683 Canis lupus familiaris
333424 Mus musculus
685758 Rattus norvegicus
429136 Gallus gallus

Protein level used designations for A4GNT

  • alpha-1,4-N-acetylglucosaminyltransferase
  • alpha 1,4-N-Acetylglucosaminyltransferase
  • alpha-1,4-N-acetylglucosaminyltransferase-like
Other products related to A4GNT such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com