A4GNT (alpha-1,4-N-Acetylglucosaminyltransferase, A4GNT)

Short Description: Necessary for the synthesis of type III mucin. Catalyzes the transfer of N-acetylglucosamine (GlcNAc) to core 2 branched O- glycans.
More information related to gene A4GNT.
Products related to A4GNT Gene:
85 Products
  • 81
  • 4
  • 52
  • 29
  • 2
  • 2
  • 42
  • 22
  • 16
  • 12
  • 1
Fusion tag
  • 32
  • 10
  • 8
  • 7
  • 6
Vector Backbone
  • 8
  • 4
  • 4
  • 4
  • 4
  • 27
  • 25
  • 12
  • 8
  • 6
  • 31
  • 25
  • 13
  • 6
  • 4
  • 3
  • 1
Resistance Gene
  • 40
  • 25
  • 14
  • 2
  • 2
Expression Type
  • 55
  • 34
  • 11
Selectable Marker
  • 19
  • 18
  • 11
  • 8
  • 1
  • 21
  • 20
  • 16
  • 8
  • 6
  • 37
  • 17
  • 16
  • 15
Supplier: Log in to see

Full length Homo sapiens alpha-1,4-N-acetylglucosaminyltransferase cDNA clone.

alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT)
Gene ID:
51146 (Human, A4GNT)
A4GNT, a4gnt, a4gnt.L, A4gnt
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3989431
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Homo sapiens alpha-1,4-N-acetylglucosaminyltransferase cDNA clone.

alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT)
Gene ID:
51146 (Human, A4GNT)
A4GNT, a4gnt, a4gnt.L, A4gnt
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3989432
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Xenopus laevis alpha-1,4-N-acetylglucosaminyltransferase cDNA clone.

alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT)
Gene ID:
734685 (Xenopus laevis, A4GNT)
A4GNT, a4gnt, a4gnt.L, A4gnt
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • M13(-21)
Glycerol Stock
-80 °C
Catalog No. ABIN4044395
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Mus musculus alpha-1,4-N-acetylglucosaminyltransferase cDNA clone.

alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT)
Gene ID:
333424 (Mouse (Murine), A4GNT)
A4GNT, a4gnt, a4gnt.L, A4gnt
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3995219
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Xenopus tropicalis alpha-1,4-N-acetylglucosaminyltransferase cDNA clone.

alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT)
Gene ID:
549416 (Xenopus tropicalis, A4GNT)
A4GNT, a4gnt, a4gnt.L, A4gnt
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4022442
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Mus musculus alpha-1,4-N-acetylglucosaminyltransferase cDNA clone.

alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT)
Gene ID:
333424 (Mouse (Murine), A4GNT)
A4GNT, a4gnt, a4gnt.L, A4gnt
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3995220
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens alpha-1,4-N-acetylglucosaminyltransferase.

alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT)
A4GNT, a4gnt, a4gnt.L, A4gnt
Vector type:
TA-Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Catalog No. ABIN3545822
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Verified forward and reverse primers for analyzing the quantitative expression of gene

Quantitative real-time PCR
A4GNT, a4gnt, MGC116495, ALPHA4GNT, alpha4GnT, AV080780, Alpha4gnt, Gm798
-20 °C
Catalog No. ABIN3192763
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens alpha-1,4-N-acetylglucosaminyltransferase cDNA clone.

alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT)
Gene ID:
51146 (Human, A4GNT)
A4GNT, a4gnt, a4gnt.L, A4gnt
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3989430
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens alpha-1,4-N-acetylglucosaminyltransferase cDNA clone.

alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT)
Gene ID:
51146 (Human, A4GNT)
A4GNT, a4gnt, a4gnt.L, A4gnt
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3989429
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Xenopus laevis alpha-1,4-N-acetylglucosaminyltransferase cDNA clone.

alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT)
Gene ID:
734685 (Xenopus laevis, A4GNT)
A4GNT, a4gnt, a4gnt.L, A4gnt
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • M13(-21)
Glycerol Stock
-80 °C
Catalog No. ABIN4044396
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Mus musculus alpha-1,4-N-acetylglucosaminyltransferase cDNA clone.

alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT)
Gene ID:
333424 (Mouse (Murine), A4GNT)
A4GNT, a4gnt, a4gnt.L, A4gnt
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3995222
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Xenopus tropicalis alpha-1,4-N-acetylglucosaminyltransferase cDNA clone.

alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT)
Gene ID:
549416 (Xenopus tropicalis, A4GNT)
A4GNT, a4gnt, a4gnt.L, A4gnt
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4022443
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Mus musculus alpha-1,4-N-acetylglucosaminyltransferase cDNA clone.

alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT)
Gene ID:
333424 (Mouse (Murine), A4GNT)
A4GNT, a4gnt, a4gnt.L, A4gnt
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3995221
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Entry clone of human cDNA (ORF) without STOP codon in Gateway pDONR223 Vector.

alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT)
Gene ID:
51146 (Human, A4GNT)
A4GNT, a4gnt, a4gnt.L, A4gnt
Insert length:
1023 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
2 μg of lyophilized gene in pDONR223 vector
-20 °C
Catalog No. ABIN5325244
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
Supplier: Log in to see

The alpha-1,4-N-acetylglucosaminyltransferase ORF clone is provided in a Gateway adapted entry vector for fast and convenient transfer to any compatible expression vector.

Protein Expression
alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT)
Gene ID:
51146 (Human, A4GNT)
A4GNT, a4gnt, a4gnt.L, A4gnt
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3414924
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Mammalian Vector with ORF clone of Human alpha-1,4-N-acetylglucosaminyltransferase (A4GNT)

Protein Expression
alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT)
NCBI Accession:
A4GNT, a4gnt, a4gnt.L, A4gnt
Insert length:
1023 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5391261
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see

Individual gRNA against A4gnt in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Genome Editing with Engineered Nucleases, Protein Expression
alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT)
NCBI Accession:
Mouse (Murine)
A4GNT, a4gnt, a4gnt.L, A4gnt
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of A4gnt
Viral Particles
-80 °C
Catalog No. ABIN5113214
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Supplier: Log in to see

Individual gRNA against A4GNT in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Genome Editing with Engineered Nucleases, Protein Expression
alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT)
NCBI Accession:
A4GNT, a4gnt, a4gnt.L, A4gnt
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of A4GNT
Viral Particles
-80 °C
Catalog No. ABIN5113212
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Supplier: Log in to see

siRNA (27 mer) kit with 3 gene-specific unique siRNA duplexes and negative control for gene knockdown.

RNA Interference
Mouse (Murine)
A4GNT, a4gnt, MGC116495, ALPHA4GNT, alpha4GnT, AV080780, Alpha4gnt, Gm798
HPLC purified
Available with shipment
  • A4gnt (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
-20 °C
Catalog No. ABIN3267570
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
  • <
  • 1

Synonyms and alternative names related to A4GNT

  • alpha-1,4-N-acetylglucosaminyltransferase (A4GNT)
  • alpha-1,4-N-acetylglucosaminyltransferase (a4gnt)
  • alpha-1,4-N-acetylglucosaminyltransferase L homeolog (a4gnt.L)
  • alpha-1,4-N-acetylglucosaminyltransferase (A4gnt)
  • A4GNT
  • a4gnt
  • alpha4GnT
  • Alpha4gnt
  • AV080780
  • Gm798
  • MGC116495

Gene-IDs for different species

460724 Pan troglodytes
549416 Xenopus (Silurana) tropicalis
716512 Macaca mulatta
734685 Xenopus laevis
100033872 Equus caballus
100462185 Pongo abelii
51146 Homo sapiens
540795 Bos taurus
485683 Canis lupus familiaris
333424 Mus musculus
685758 Rattus norvegicus
429136 Gallus gallus

Protein level used designations for A4GNT

  • alpha-1,4-N-acetylglucosaminyltransferase
  • alpha 1,4-N-Acetylglucosaminyltransferase
  • alpha-1,4-N-acetylglucosaminyltransferase-like
Other products related to A4GNT such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com