AADACL3 (Arylacetamide Deacetylase-Like 3, AADACL3)

Products related to AADACL3 Gene:
Type
  • 70
  • 2
Species
  • 29
  • 26
  • 17
Application
  • 42
  • 16
  • 16
  • 10
Fusion tag
  • 22
  • 12
  • 11
  • 8
  • 6
Vector Backbone
  • 7
  • 6
  • 6
  • 6
  • 6
Vector
  • 34
  • 20
  • 8
  • 6
  • 2
Insert
  • 20
  • 20
  • 14
  • 8
  • 6
Oligo-Type
  • 2
Resistance Gene
  • 27
  • 25
  • 16
  • 2
  • 2
Expression Type
  • 70
  • 39
Selectable Marker
  • 22
  • 21
Promoter
  • 26
  • 24
  • 8
  • 8
  • 6
Format
  • 28
  • 22
  • 18
  • 4
72 Products
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
Arylacetamide Deacetylase-Like 3 (AADACL3)
NCBI Accession:
NM_001103170
Gene ID:
126767 (Human, AADACL3)
Synonyms:
AADACL3, AADACL4L5, Aadacl3
Insert length:
1224 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4933727
$289.00
10 μg
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Arylacetamide Deacetylase-Like 3 (AADACL3)
NCBI Accession:
NM_001085503
Species:
Mouse
Synonyms:
AADACL3, AADACL4L5, Aadacl3
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Aadacl3
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5135548
$420.00
300 μL
Plus shipping costs $45.00 and $24.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Arylacetamide Deacetylase-Like 3 (AADACL3)
NCBI Accession:
NM_001191768
Species:
Rat
Synonyms:
AADACL3, AADACL4L5, Aadacl3
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Aadacl3
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5135550
$420.00
300 μL
Plus shipping costs $45.00 and $24.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Arylacetamide Deacetylase-Like 3 (AADACL3)
NCBI Accession:
NM_001103169
Species:
Human
Synonyms:
AADACL3, AADACL4L5, Aadacl3
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of AADACL3
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5135546
$420.00
300 μL
Plus shipping costs $45.00 and $24.00 dry ice
Available

Type:
cDNA
Application:
Protein Expression
Gene:
Arylacetamide Deacetylase-Like 3 (AADACL3)
NCBI Accession:
NM_001085503,NP_001078972
Species:
Mouse
Synonyms:
AADACL3, AADACL4L5, Aadacl3
Insert length:
1227 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3308233
$430.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Arylacetamide Deacetylase-Like 3 (AADACL3)
Species:
Rat
Synonyms:
AADACL3, AADACL4L5, Aadacl3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5430080
$430.00
10 μg
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Arylacetamide Deacetylase-Like 3 (AADACL3)
NCBI Accession:
NM_001191768,NP_001178697
Species:
Rat
Synonyms:
AADACL3, AADACL4L5, Aadacl3
Insert length:
1227 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3308234
$430.00
10 μg
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Arylacetamide Deacetylase-Like 3 (AADACL3)
NCBI Accession:
NM_001103169,NP_001096639
Species:
Human
Synonyms:
AADACL3, AADACL4L5, Aadacl3
Insert length:
843 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5430078
$433.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Arylacetamide Deacetylase-Like 3 (AADACL3)
NCBI Accession:
NM_001103170,NP_001096640
Species:
Human
Synonyms:
AADACL3, AADACL4L5, Aadacl3
Insert length:
1053 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5430079
$433.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Application:
RNA Interference
Gene:
Arylacetamide Deacetylase-Like 3
Species:
Mouse
Synonyms:
Gm435, RGD1563257, AADACL3
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Aadacl3 (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3269649
$440.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
Arylacetamide Deacetylase-Like 3
Species:
Human
Synonyms:
Gm435, RGD1563257, AADACL3
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • AADACL3 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3311949
$440.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Arylacetamide Deacetylase-Like 3 (AADACL3)
Species:
Human
Synonyms:
AADACL3, AADACL4L5, Aadacl3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC-GFP
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
GFP tag
Expression:
Stable, Transient

Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5430076
$470.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Arylacetamide Deacetylase-Like 3 (AADACL3)
Species:
Human
Synonyms:
AADACL3, AADACL4L5, Aadacl3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC-GFP
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
GFP tag
Expression:
Stable, Transient

Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5430077
$470.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Arylacetamide Deacetylase-Like 3 (AADACL3)
Gene ID:
126767 (Human, AADACL3)
Synonyms:
AADACL3, AADACL4L5, Aadacl3
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter, U6 Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable

Viral particles:
ABIN5049005

Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN5030060
$503.00
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Arylacetamide Deacetylase-Like 3 (AADACL3)
NCBI Accession:
NM_001103169
Species:
Human
Synonyms:
AADACL3, AADACL4L5, Aadacl3
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of AADACL3
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5251009
$520.00
300 μL
Plus shipping costs $45.00 and $24.00 dry ice
Available

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Arylacetamide Deacetylase-Like 3 (AADACL3)
NCBI Accession:
NM_001085503
Species:
Mouse
Synonyms:
AADACL3, AADACL4L5, Aadacl3
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Aadacl3
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5251011
$520.00
300 μL
Plus shipping costs $45.00 and $24.00 dry ice
Available

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Arylacetamide Deacetylase-Like 3 (AADACL3)
NCBI Accession:
NM_001191768
Species:
Rat
Synonyms:
AADACL3, AADACL4L5, Aadacl3
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Aadacl3
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5251013
$520.00
300 μL
Plus shipping costs $45.00 and $24.00 dry ice
Available

Type:
cDNA
Application:
Cloning
Gene:
Arylacetamide Deacetylase-Like 3 (AADACL3)
NCBI Accession:
NM_001191768
Species:
Rat
Synonyms:
AADACL3, AADACL4L5, Aadacl3
Insert length:
1227 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4741210
$570.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Arylacetamide Deacetylase-Like 3 (AADACL3)
NCBI Accession:
NM_001191768
Species:
Rat
Synonyms:
AADACL3, AADACL4L5, Aadacl3
Insert length:
1227 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4679953
$570.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Arylacetamide Deacetylase-Like 3 (AADACL3)
NCBI Accession:
NM_001191768
Species:
Rat
Synonyms:
AADACL3, AADACL4L5, Aadacl3
Insert length:
1227 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-N-D-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag,HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4542414
$570.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to AADACL3

  • arylacetamide deacetylase like 3 (AADACL3)
  • arylacetamide deacetylase-like 4-like 5 (AADACL4L5)
  • arylacetamide deacetylase like 3 (Aadacl3)
  • arylacetamide deacetylase-like 3 (Aadacl3)
  • AADACL3
  • Gm435
  • RGD1563257

Gene-IDs for different species

GENE IDSPECIES
457970 Pan troglodytes
768668 Gallus gallus
126767 Homo sapiens
230883 Mus musculus
487435 Canis lupus familiaris
313686 Rattus norvegicus
530613 Bos taurus

Protein level used designations for AADACL3

  • arylacetamide deacetylase-like 3
Other products related to AADACL3 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com