AADACL3 (Arylacetamide Deacetylase-Like 3, AADACL3)

Products related to AADACL3 Gene:
76 Products
  • 72
  • 4
  • 31
  • 28
  • 17
  • 4
  • 20
  • 20
  • 16
  • 8
  • 6
  • 34
  • 22
  • 8
  • 6
  • 2
Vector Backbone
  • 7
  • 6
  • 6
  • 6
  • 6
Fusion tag
  • 24
  • 14
  • 11
  • 8
  • 6
Resistance Gene
  • 27
  • 27
  • 16
  • 2
  • 2
Selectable Marker
  • 23
  • 22
  • 28
  • 26
  • 8
  • 8
  • 6
Expression Type
  • 72
  • 41
  • 42
  • 20
  • 16
  • 10
  • 32
  • 22
  • 18
  • 4
Supplier: Log in to see
ISO 9001:2008

Expression/transfection ready cDNA ORF clone of Human AADACL3 with C terminal DYKDDDDK tag is ideal for express proteins in E.coli & mammalian cells.

Protein Expression
Arylacetamide Deacetylase-Like 3 (AADACL3)
NCBI Accession:
Gene ID:
126767 (Human, AADACL3)
Insert length:
1224 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
RT/-20 °C
Catalog No. ABIN4933727
10 μg
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Rat Aadacl3 is ideal for over-expression of native protein for functional studies.

Protein Expression
Arylacetamide Deacetylase-Like 3 (AADACL3)
NCBI Accession:
Rat (Rattus)
Insert length:
1227 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
Catalog No. ABIN3308234
10 μg
Plus shipping costs €45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

siRNA (27 mer) kit with 3 gene-specific unique siRNA duplexes and negative control for gene knockdown.

RNA Interference
Arylacetamide Deacetylase-Like 3
Mouse (Murine)
Gm435, RGD1563257, AADACL3
HPLC purified
Available with shipment
  • Aadacl3 (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
-20 °C
Catalog No. ABIN3269649
1 kit
Plus shipping costs €45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

siRNA (27 mer) kit with 3 gene-specific unique siRNA duplexes and negative control for gene knockdown.

RNA Interference
Arylacetamide Deacetylase-Like 3
Gm435, RGD1563257, AADACL3
HPLC purified
Available with shipment
  • AADACL3 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
-20 °C
Catalog No. ABIN3311949
1 kit
Plus shipping costs €45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Aadacl3 is ideal for over-expression of native protein for functional studies.

Protein Expression
Arylacetamide Deacetylase-Like 3 (AADACL3)
NCBI Accession:
Mouse (Murine)
Insert length:
1227 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
Catalog No. ABIN3308233
10 μg
Plus shipping costs €45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Individual gRNA against AADACL3 in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Genome Editing with Engineered Nucleases, Protein Expression
Arylacetamide Deacetylase-Like 3 (AADACL3)
NCBI Accession:
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of AADACL3
Viral Particles
-80 °C
Catalog No. ABIN5135546
300 μL
Plus shipping costs €45.00 and €20.00 dry ice
Supplier: Log in to see

Individual gRNA against Aadacl3 in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Genome Editing with Engineered Nucleases, Protein Expression
Arylacetamide Deacetylase-Like 3 (AADACL3)
NCBI Accession:
Mouse (Murine)
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Aadacl3
Viral Particles
-80 °C
Catalog No. ABIN5135548
300 μL
Plus shipping costs €45.00 and €20.00 dry ice
Supplier: Log in to see

Individual gRNA against Aadacl3 in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Genome Editing with Engineered Nucleases, Protein Expression
Arylacetamide Deacetylase-Like 3 (AADACL3)
NCBI Accession:
Rat (Rattus)
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Aadacl3
Viral Particles
-80 °C
Catalog No. ABIN5135550
300 μL
Plus shipping costs €45.00 and €20.00 dry ice
Supplier: Log in to see

Mammalian Vector with ORF clone of Rat arylacetamide deacetylase-like 3 (Aadacl3)

Protein Expression
Arylacetamide Deacetylase-Like 3 (AADACL3)
Rat (Rattus)
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5430080
10 μg
Plus shipping costs €45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Mammalian Vector with ORF clone of Human arylacetamide deacetylase-like 3 (AADACL3) transcript variant 1

Protein Expression
Arylacetamide Deacetylase-Like 3 (AADACL3)
NCBI Accession:
Insert length:
1053 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5430079
10 μg
Plus shipping costs €45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see

ORF Cloning-Vector holds the gene between an AflII and EcoRV cut site.

Arylacetamide Deacetylase-Like 3 (AADACL3)
NCBI Accession:
Mouse (Murine)
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5749265
1 μg
Plus shipping costs €45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

ORF Cloning-Vector holds the gene between an AflII and EcoRV cut site.

Arylacetamide Deacetylase-Like 3 (AADACL3)
NCBI Accession:
Rat (Rattus)
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5749266
1 μg
Plus shipping costs €45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

siRNA to inhibit AADACL3 expression using RNA interference.

RNA Interference
Arylacetamide Deacetylase-Like 3
Gene ID:
126767 (Human, AADACL3)
Gm435, RGD1563257, AADACL3
Oligonucleotide synthesis is monitored base by base through trityl analysis to ensure appropriate coupling efficiency. The oligo is subsequently purified by affinity-solid phase extraction. The annealed RNA duplex is further analyzed by mass spectrometry to verify the exact composition of the duplex. Each lot is compared to the previous lot by mass spectrometry to ensure maximum lot-to-lot consistency.
This product is provided as two 5 nmol vials (10 nmol), three 5 nmol vials (15 nmol) or 2x three 5 nmol vials (30 nmol) of lyophilized siRNA oligo duplexes. Each vial contains slightly different sequences to ensure full knockout of the gene. Each vial contains slightly different sequences to ensure full knockout of the gene. The duplexes can be transfected individually or pooled together to achieve knockdown of the target gene, which is most commonly assessed by qPCR or western blot. The siRNA oligos are also chemically modified (2'-OMe) for increased stability and enhanced knockdown in vitro and in vivo.
-20 °C
Catalog No. ABIN5795609
15 nmol
Plus shipping costs €45.00
Delivery in 16 to 26 Business Days
Supplier: Log in to see

siRNA to inhibit AADACL3 expression using RNA interference.

RNA Interference
Arylacetamide Deacetylase-Like 3
Gene ID:
230883 (Mouse (Murine), AADACL3)
Gm435, RGD1563257, AADACL3
Oligonucleotide synthesis is monitored base by base through trityl analysis to ensure appropriate coupling efficiency. The oligo is subsequently purified by affinity-solid phase extraction. The annealed RNA duplex is further analyzed by mass spectrometry to verify the exact composition of the duplex. Each lot is compared to the previous lot by mass spectrometry to ensure maximum lot-to-lot consistency.
This product is provided as two 5 nmol vials (10 nmol), three 5 nmol vials (15 nmol) or 2x three 5 nmol vials (30 nmol) of lyophilized siRNA oligo duplexes. Each vial contains slightly different sequences to ensure full knockout of the gene. Each vial contains slightly different sequences to ensure full knockout of the gene. The duplexes can be transfected individually or pooled together to achieve knockdown of the target gene, which is most commonly assessed by qPCR or western blot. The siRNA oligos are also chemically modified (2'-OMe) for increased stability and enhanced knockdown in vitro and in vivo.
-20 °C
Catalog No. ABIN5795608
15 nmol
Plus shipping costs €45.00
Delivery in 16 to 26 Business Days
Supplier: Log in to see

Mammalian Vector with ORF clone of Human arylacetamide deacetylase-like 3 (AADACL3) transcript variant 2

Protein Expression
Arylacetamide Deacetylase-Like 3 (AADACL3)
NCBI Accession:
Insert length:
843 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5430078
10 μg
Plus shipping costs €45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see

Mammalian Vector with ORF clone of Human arylacetamide deacetylase-like 3 (AADACL3) transcript variant 1

Protein Expression
Arylacetamide Deacetylase-Like 3 (AADACL3)
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
GFP tag
Stable, Transient

The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5430077
10 μg
Plus shipping costs €45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - with 3 vectors containing two gRNAs in each vector plus a negative control (glycerol stock)

Genome Editing with Engineered Nucleases
Arylacetamide Deacetylase-Like 3 (AADACL3)
Gene ID:
126767 (Human, AADACL3)
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
SFFV Promoter, U6 Promoter
Fusion Tag:
Transient, Stable

Viral particles:

- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Glycerol Stock
-80 °C
Catalog No. ABIN5030060
1 set
Plus shipping costs €45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Individual gRNA against AADACL3 in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (sgRNA and Cas9 in a single vector)

gRNA + Cas9
Genome Editing with Engineered Nucleases, Protein Expression
Arylacetamide Deacetylase-Like 3 (AADACL3)
NCBI Accession:
Vector type:
Lentiviral Vector
Resistance Gene:
Selection Marker:
U6 Promoter, SFFV Promoter
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of AADACL3
Viral Particles
-80 °C
Catalog No. ABIN5251009
300 μL
Plus shipping costs €45.00 and €20.00 dry ice
Supplier: Log in to see

Individual gRNA against Aadacl3 in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (sgRNA and Cas9 in a single vector)

gRNA + Cas9
Genome Editing with Engineered Nucleases, Protein Expression
Arylacetamide Deacetylase-Like 3 (AADACL3)
NCBI Accession:
Mouse (Murine)
Vector type:
Lentiviral Vector
Resistance Gene:
Selection Marker:
U6 Promoter, SFFV Promoter
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Aadacl3
Viral Particles
-80 °C
Catalog No. ABIN5251011
300 μL
Plus shipping costs €45.00 and €20.00 dry ice
Supplier: Log in to see

Individual gRNA against Aadacl3 in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (sgRNA and Cas9 in a single vector)

gRNA + Cas9
Genome Editing with Engineered Nucleases, Protein Expression
Arylacetamide Deacetylase-Like 3 (AADACL3)
NCBI Accession:
Rat (Rattus)
Vector type:
Lentiviral Vector
Resistance Gene:
Selection Marker:
U6 Promoter, SFFV Promoter
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Aadacl3
Viral Particles
-80 °C
Catalog No. ABIN5251013
300 μL
Plus shipping costs €45.00 and €20.00 dry ice
  • <
  • 1

Synonyms and alternative names related to AADACL3

  • arylacetamide deacetylase like 3 (AADACL3)
  • arylacetamide deacetylase-like 4-like 5 (AADACL4L5)
  • arylacetamide deacetylase like 3 (Aadacl3)
  • arylacetamide deacetylase-like 3 (Aadacl3)
  • Gm435
  • RGD1563257

Gene-IDs for different species

457970 Pan troglodytes
768668 Gallus gallus
126767 Homo sapiens
230883 Mus musculus
487435 Canis lupus familiaris
313686 Rattus norvegicus
530613 Bos taurus

Protein level used designations for AADACL3

  • arylacetamide deacetylase-like 3
Other products related to AADACL3 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com