AADACL4 (Arylacetamide Deacetylase-Like 4, AADACL4)

Products related to AADACL4 Gene:
50 Products
  • 46
  • 4
  • 24
  • 24
  • 2
  • 4
  • 12
  • 12
  • 10
  • 6
  • 4
  • 20
  • 13
  • 6
  • 4
  • 3
Vector Backbone
  • 4
  • 4
  • 3
  • 3
  • 3
Fusion tag
  • 19
  • 10
  • 6
  • 4
  • 3
Resistance Gene
  • 18
  • 15
  • 12
  • 2
  • 1
Selectable Marker
  • 16
  • 14
  • 22
  • 15
  • 6
  • 4
  • 4
Expression Type
  • 44
  • 28
  • 23
  • 16
  • 12
  • 7
  • 23
  • 14
  • 9
  • 4
Supplier: Log in to see

Full length Xenopus laevis arylacetamide deacetylase-like 4 cDNA clone.

Arylacetamide Deacetylase-Like 4 (AADACL4)
Gene ID:
495387 (Xenopus laevis, AADACL4)
AADACL4, aadacl4.S, aadacl4, Aadacl4, AADACL4L3, LOC100218769, LOC100713568
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • M13(-21)
Glycerol Stock
-80 °C
Catalog No. ABIN4043061
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Xenopus laevis arylacetamide deacetylase-like 4 cDNA clone.

Arylacetamide Deacetylase-Like 4 (AADACL4)
Gene ID:
495387 (Xenopus laevis, AADACL4)
AADACL4, aadacl4.S, aadacl4, Aadacl4, AADACL4L3, LOC100218769, LOC100713568
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • M13(-21)
Glycerol Stock
-80 °C
Catalog No. ABIN4043060
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Gm13177 is ideal for over-expression of native protein for functional studies.

Protein Expression
Arylacetamide Deacetylase-Like 4 (AADACL4)
NCBI Accession:
Mouse (Murine)
AADACL4, aadacl4.S, aadacl4, Aadacl4, AADACL4L3, LOC100218769, LOC100713568
Insert length:
1224 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
Catalog No. ABIN3323116
10 μg
Plus shipping costs €45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

siRNA (27 mer) kit with 3 gene-specific unique siRNA duplexes and negative control for gene knockdown.

RNA Interference
Arylacetamide Deacetylase-Like 4
Mouse (Murine)
RGD1565761, OTTMUSG00000010747, Aadacl4
HPLC purified
Available with shipment
  • Gm13177 (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
-20 °C
Catalog No. ABIN3269619
1 kit
Plus shipping costs €45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

siRNA (27 mer) kit with 3 gene-specific unique siRNA duplexes and negative control for gene knockdown.

RNA Interference
Arylacetamide Deacetylase-Like 4
RGD1565761, OTTMUSG00000010747, Aadacl4
HPLC purified
Available with shipment
  • AADACL4 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
-20 °C
Catalog No. ABIN3314575
1 kit
Plus shipping costs €45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Individual gRNA against AADACL4 in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Genome Editing with Engineered Nucleases, Protein Expression
Arylacetamide Deacetylase-Like 4 (AADACL4)
NCBI Accession:
AADACL4, aadacl4.S, aadacl4, Aadacl4, AADACL4L3, LOC100218769, LOC100713568
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of AADACL4
Viral Particles
-80 °C
Catalog No. ABIN5128146
300 μL
Plus shipping costs €45.00 and €20.00 dry ice
Supplier: Log in to see

Individual gRNA against Gm13177 in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Genome Editing with Engineered Nucleases, Protein Expression
Arylacetamide Deacetylase-Like 4 (AADACL4)
NCBI Accession:
Mouse (Murine)
AADACL4, aadacl4.S, aadacl4, Aadacl4, AADACL4L3, LOC100218769, LOC100713568
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Gm13177
Viral Particles
-80 °C
Catalog No. ABIN5194532
300 μL
Plus shipping costs €45.00 and €20.00 dry ice
Supplier: Log in to see

ORF Cloning-Vector holds the gene between an AflII and EcoRV cut site.

Arylacetamide Deacetylase-Like 4 (AADACL4)
NCBI Accession:
Mouse (Murine)
AADACL4, aadacl4.S, aadacl4, Aadacl4, AADACL4L3, LOC100218769, LOC100713568
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5724499
1 μg
Plus shipping costs €45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

siRNA to inhibit AADACL4 expression using RNA interference.

RNA Interference
Arylacetamide Deacetylase-Like 4
Gene ID:
381572 (Mouse (Murine), AADACL4)
RGD1565761, OTTMUSG00000010747, Aadacl4
Oligonucleotide synthesis is monitored base by base through trityl analysis to ensure appropriate coupling efficiency. The oligo is subsequently purified by affinity-solid phase extraction. The annealed RNA duplex is further analyzed by mass spectrometry to verify the exact composition of the duplex. Each lot is compared to the previous lot by mass spectrometry to ensure maximum lot-to-lot consistency.
This product is provided as two 5 nmol vials (10 nmol), three 5 nmol vials (15 nmol) or 2x three 5 nmol vials (30 nmol) of lyophilized siRNA oligo duplexes. Each vial contains slightly different sequences to ensure full knockout of the gene. Each vial contains slightly different sequences to ensure full knockout of the gene. The duplexes can be transfected individually or pooled together to achieve knockdown of the target gene, which is most commonly assessed by qPCR or western blot. The siRNA oligos are also chemically modified (2'-OMe) for increased stability and enhanced knockdown in vitro and in vivo.
-20 °C
Catalog No. ABIN5793399
15 nmol
Plus shipping costs €45.00
Delivery in 16 to 26 Business Days
Supplier: Log in to see

siRNA to inhibit AADACL4 expression using RNA interference.

RNA Interference
Arylacetamide Deacetylase-Like 4
Gene ID:
343066 (Human, AADACL4)
RGD1565761, OTTMUSG00000010747, Aadacl4
Oligonucleotide synthesis is monitored base by base through trityl analysis to ensure appropriate coupling efficiency. The oligo is subsequently purified by affinity-solid phase extraction. The annealed RNA duplex is further analyzed by mass spectrometry to verify the exact composition of the duplex. Each lot is compared to the previous lot by mass spectrometry to ensure maximum lot-to-lot consistency.
This product is provided as two 5 nmol vials (10 nmol), three 5 nmol vials (15 nmol) or 2x three 5 nmol vials (30 nmol) of lyophilized siRNA oligo duplexes. Each vial contains slightly different sequences to ensure full knockout of the gene. Each vial contains slightly different sequences to ensure full knockout of the gene. The duplexes can be transfected individually or pooled together to achieve knockdown of the target gene, which is most commonly assessed by qPCR or western blot. The siRNA oligos are also chemically modified (2'-OMe) for increased stability and enhanced knockdown in vitro and in vivo.
-20 °C
Catalog No. ABIN5793400
15 nmol
Plus shipping costs €45.00
Delivery in 16 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - with 3 vectors containing two gRNAs in each vector plus a negative control (glycerol stock)

Genome Editing with Engineered Nucleases
Arylacetamide Deacetylase-Like 4 (AADACL4)
Gene ID:
343066 (Human, AADACL4)
AADACL4, aadacl4.S, aadacl4, Aadacl4, AADACL4L3, LOC100218769, LOC100713568
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
SFFV Promoter, U6 Promoter
Fusion Tag:
Transient, Stable

Viral particles:

- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Glycerol Stock
-80 °C
Catalog No. ABIN5035760
1 set
Plus shipping costs €45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Individual gRNA against AADACL4 in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (sgRNA and Cas9 in a single vector)

gRNA + Cas9
Genome Editing with Engineered Nucleases, Protein Expression
Arylacetamide Deacetylase-Like 4 (AADACL4)
NCBI Accession:
AADACL4, aadacl4.S, aadacl4, Aadacl4, AADACL4L3, LOC100218769, LOC100713568
Vector type:
Lentiviral Vector
Resistance Gene:
Selection Marker:
U6 Promoter, SFFV Promoter
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of AADACL4
Viral Particles
-80 °C
Catalog No. ABIN5243575
300 μL
Plus shipping costs €45.00 and €20.00 dry ice
Supplier: Log in to see

Individual gRNA against Gm13177 in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (sgRNA and Cas9 in a single vector)

gRNA + Cas9
Genome Editing with Engineered Nucleases, Protein Expression
Arylacetamide Deacetylase-Like 4 (AADACL4)
NCBI Accession:
Mouse (Murine)
AADACL4, aadacl4.S, aadacl4, Aadacl4, AADACL4L3, LOC100218769, LOC100713568
Vector type:
Lentiviral Vector
Resistance Gene:
Selection Marker:
U6 Promoter, SFFV Promoter
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Gm13177
Viral Particles
-80 °C
Catalog No. ABIN5310148
300 μL
Plus shipping costs €45.00 and €20.00 dry ice
Supplier: Log in to see

Mammalian Vector with ORF clone of Human arylacetamide deacetylase-like 4 (AADACL4)

Protein Expression
Arylacetamide Deacetylase-Like 4 (AADACL4)
NCBI Accession:
AADACL4, aadacl4.S, aadacl4, Aadacl4, AADACL4L3, LOC100218769, LOC100713568
Insert length:
1224 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5417995
10 μg
Plus shipping costs €45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see

Mammalian expression of Mouse Gm13177 with HA tag

Protein Expression
Arylacetamide Deacetylase-Like 4 (AADACL4)
NCBI Accession:
Mouse (Murine)
AADACL4, aadacl4.S, aadacl4, Aadacl4, AADACL4L3, LOC100218769, LOC100713568
Insert length:
1224 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
HA tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4444533
500 ng
Plus shipping costs €45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Mammalian expression of Mouse Gm13177 with His tag

Protein Expression
Arylacetamide Deacetylase-Like 4 (AADACL4)
NCBI Accession:
Mouse (Murine)
AADACL4, aadacl4.S, aadacl4, Aadacl4, AADACL4L3, LOC100218769, LOC100713568
Insert length:
1224 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
His tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4411153
500 ng
Plus shipping costs €45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Mammalian expression of Mouse Gm13177 with DYKDDDDK Tag,His tag

Protein Expression
Arylacetamide Deacetylase-Like 4 (AADACL4)
NCBI Accession:
Mouse (Murine)
AADACL4, aadacl4.S, aadacl4, Aadacl4, AADACL4L3, LOC100218769, LOC100713568
Insert length:
1224 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag,His tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4586633
500 ng
Plus shipping costs €45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Mouse Gm13177 with His-MBP

Arylacetamide Deacetylase-Like 4 (AADACL4)
NCBI Accession:
Mouse (Murine)
AADACL4, aadacl4.S, aadacl4, Aadacl4, AADACL4L3, LOC100218769, LOC100713568
Insert length:
1224 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4724199
500 ng
Plus shipping costs €45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Mammalian expression of Mouse Gm13177 with DYKDDDDK Tag,HA tag

Protein Expression
Arylacetamide Deacetylase-Like 4 (AADACL4)
NCBI Accession:
Mouse (Murine)
AADACL4, aadacl4.S, aadacl4, Aadacl4, AADACL4L3, LOC100218769, LOC100713568
Insert length:
1224 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4525429
500 ng
Plus shipping costs €45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Mouse Gm13177 with His tag

Arylacetamide Deacetylase-Like 4 (AADACL4)
NCBI Accession:
Mouse (Murine)
AADACL4, aadacl4.S, aadacl4, Aadacl4, AADACL4L3, LOC100218769, LOC100713568
Insert length:
1224 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4643850
500 ng
Plus shipping costs €45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to AADACL4

  • arylacetamide deacetylase like 4 (AADACL4)
  • arylacetamide deacetylase-like 4 S homeolog (aadacl4.S)
  • arylacetamide deacetylase-like 4 (aadacl4)
  • arylacetamide deacetylase-like 4 (Aadacl4)
  • arylacetamide deacetylase-like 4-like 3 (AADACL4L3)
  • arylacetamide deacetylase like 4 (Aadacl4)
  • arylacetamide deacetylase-like 4 (LOC100218769)
  • arylacetamide deacetylase-like 4 (LOC100713568)
  • Aadacl4
  • OTTMUSG00000010747
  • RGD1565761

Gene-IDs for different species

343066 Homo sapiens
469815 Pan troglodytes
495387 Xenopus laevis
569798 Danio rerio
715600 Macaca mulatta
100445261 Pongo abelii
313688 Rattus norvegicus
419479 Gallus gallus
435815 Mus musculus
607688 Canis lupus familiaris
100218769 Taeniopygia guttata
100386770 Callithrix jacchus
100599857 Nomascus leucogenys
529424 Bos taurus
100713568 Cavia porcellus
100349449 Oryctolagus cuniculus
100515144 Sus scrofa

Protein level used designations for AADACL4

  • arylacetamide deacetylase-like 4
Other products related to AADACL4 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com