AADACL4 (Arylacetamide Deacetylase-Like 4, AADACL4)

Products related to AADACL4 Gene:
50 Products
Type
  • 46
  • 4
Species
  • 24
  • 24
  • 2
Application
  • 23
  • 16
  • 12
  • 7
Fusion tag
  • 19
  • 10
  • 6
  • 4
  • 3
Vector Backbone
  • 4
  • 4
  • 3
  • 3
  • 3
Vector
  • 20
  • 13
  • 6
  • 4
  • 3
Insert
  • 12
  • 12
  • 10
  • 6
  • 4
Oligo-Type
  • 4
Resistance Gene
  • 18
  • 15
  • 12
  • 2
  • 1
Expression Type
  • 44
  • 28
Selectable Marker
  • 16
  • 14
Promoter
  • 22
  • 15
  • 6
  • 4
  • 4
Format
  • 23
  • 14
  • 9
  • 4
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Arylacetamide Deacetylase-Like 4 (AADACL4)
Gene ID:
495387 (Xenopus laevis, AADACL4)
Synonyms:
AADACL4, aadacl4.S, aadacl4, Aadacl4, AADACL4L3, LOC100218769, LOC100713568
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4043061
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Arylacetamide Deacetylase-Like 4 (AADACL4)
Gene ID:
495387 (Xenopus laevis, AADACL4)
Synonyms:
AADACL4, aadacl4.S, aadacl4, Aadacl4, AADACL4L3, LOC100218769, LOC100713568
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4043060
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Arylacetamide Deacetylase-Like 4 (AADACL4)
NCBI Accession:
NM_001013630,NP_001013652
Species:
Human
Synonyms:
AADACL4, aadacl4.S, aadacl4, Aadacl4, AADACL4L3, LOC100218769, LOC100713568
Insert length:
1224 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5417995
$410.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression
Gene:
Arylacetamide Deacetylase-Like 4 (AADACL4)
NCBI Accession:
NM_001081248,NP_001074717
Species:
Mouse (Murine)
Synonyms:
AADACL4, aadacl4.S, aadacl4, Aadacl4, AADACL4L3, LOC100218769, LOC100713568
Insert length:
1224 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3323116
$410.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Application:
RNA Interference
Gene:
Arylacetamide Deacetylase-Like 4
Species:
Mouse (Murine)
Synonyms:
RGD1565761, OTTMUSG00000010747, Aadacl4
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Gm13177 (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3269619
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Arylacetamide Deacetylase-Like 4 (AADACL4)
NCBI Accession:
NM_001081248
Species:
Mouse (Murine)
Synonyms:
AADACL4, aadacl4.S, aadacl4, Aadacl4, AADACL4L3, LOC100218769, LOC100713568
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Gm13177
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5194532
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
Supplier: Log in to see

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Arylacetamide Deacetylase-Like 4 (AADACL4)
NCBI Accession:
NM_001013630
Species:
Human
Synonyms:
AADACL4, aadacl4.S, aadacl4, Aadacl4, AADACL4L3, LOC100218769, LOC100713568
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of AADACL4
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5128146
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
Supplier: Log in to see

Application:
RNA Interference
Gene:
Arylacetamide Deacetylase-Like 4
Species:
Human
Synonyms:
RGD1565761, OTTMUSG00000010747, Aadacl4
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • AADACL4 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3314575
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Cloning
Gene:
Arylacetamide Deacetylase-Like 4 (AADACL4)
NCBI Accession:
NM_001081248
Species:
Mouse (Murine)
Synonyms:
AADACL4, aadacl4.S, aadacl4, Aadacl4, AADACL4L3, LOC100218769, LOC100713568
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5724499
$475.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Application:
RNA Interference
Gene:
Arylacetamide Deacetylase-Like 4
Gene ID:
381572 (Mouse (Murine), AADACL4)
Synonyms:
RGD1565761, OTTMUSG00000010747, Aadacl4
Purification:
Oligonucleotide synthesis is monitored base by base through trityl analysis to ensure appropriate coupling efficiency. The oligo is subsequently purified by affinity-solid phase extraction. The annealed RNA duplex is further analyzed by mass spectrometry to verify the exact composition of the duplex. Each lot is compared to the previous lot by mass spectrometry to ensure maximum lot-to-lot consistency.
Components:
This product is provided as two 5 nmol vials (10 nmol), three 5 nmol vials (15 nmol) or 2x three 5 nmol vials (30 nmol) of lyophilized siRNA oligo duplexes. Each vial contains slightly different sequences to ensure full knockout of the gene. Each vial contains slightly different sequences to ensure full knockout of the gene. The duplexes can be transfected individually or pooled together to achieve knockdown of the target gene, which is most commonly assessed by qPCR or western blot. The siRNA oligos are also chemically modified (2'-OMe) for increased stability and enhanced knockdown in vitro and in vivo.
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5793399
$516.85
Plus shipping costs $45.00
Delivery in 16 to 26 Business Days
Supplier: Log in to see

Application:
RNA Interference
Gene:
Arylacetamide Deacetylase-Like 4
Gene ID:
343066 (Human, AADACL4)
Synonyms:
RGD1565761, OTTMUSG00000010747, Aadacl4
Purification:
Oligonucleotide synthesis is monitored base by base through trityl analysis to ensure appropriate coupling efficiency. The oligo is subsequently purified by affinity-solid phase extraction. The annealed RNA duplex is further analyzed by mass spectrometry to verify the exact composition of the duplex. Each lot is compared to the previous lot by mass spectrometry to ensure maximum lot-to-lot consistency.
Components:
This product is provided as two 5 nmol vials (10 nmol), three 5 nmol vials (15 nmol) or 2x three 5 nmol vials (30 nmol) of lyophilized siRNA oligo duplexes. Each vial contains slightly different sequences to ensure full knockout of the gene. Each vial contains slightly different sequences to ensure full knockout of the gene. The duplexes can be transfected individually or pooled together to achieve knockdown of the target gene, which is most commonly assessed by qPCR or western blot. The siRNA oligos are also chemically modified (2'-OMe) for increased stability and enhanced knockdown in vitro and in vivo.
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5793400
$516.85
Plus shipping costs $45.00
Delivery in 16 to 26 Business Days
Supplier: Log in to see

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Arylacetamide Deacetylase-Like 4 (AADACL4)
Gene ID:
343066 (Human, AADACL4)
Synonyms:
AADACL4, aadacl4.S, aadacl4, Aadacl4, AADACL4L3, LOC100218769, LOC100713568
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter, U6 Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable

Viral particles:
ABIN5054705

Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN5035760
$503.00
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Arylacetamide Deacetylase-Like 4 (AADACL4)
NCBI Accession:
NM_001081248
Species:
Mouse (Murine)
Synonyms:
AADACL4, aadacl4.S, aadacl4, Aadacl4, AADACL4L3, LOC100218769, LOC100713568
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Gm13177
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5310148
$520.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
Supplier: Log in to see

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Arylacetamide Deacetylase-Like 4 (AADACL4)
NCBI Accession:
NM_001013630
Species:
Human
Synonyms:
AADACL4, aadacl4.S, aadacl4, Aadacl4, AADACL4L3, LOC100218769, LOC100713568
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of AADACL4
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5243575
$520.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression
Gene:
Arylacetamide Deacetylase-Like 4 (AADACL4)
NCBI Accession:
NM_001081248
Species:
Mouse (Murine)
Synonyms:
AADACL4, aadacl4.S, aadacl4, Aadacl4, AADACL4L3, LOC100218769, LOC100713568
Insert length:
1224 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4411153
$570.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression
Gene:
Arylacetamide Deacetylase-Like 4 (AADACL4)
NCBI Accession:
NM_001081248
Species:
Mouse (Murine)
Synonyms:
AADACL4, aadacl4.S, aadacl4, Aadacl4, AADACL4L3, LOC100218769, LOC100713568
Insert length:
1224 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4444533
$570.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Arylacetamide Deacetylase-Like 4 (AADACL4)
NCBI Accession:
NM_001081248
Species:
Mouse (Murine)
Synonyms:
AADACL4, aadacl4.S, aadacl4, Aadacl4, AADACL4L3, LOC100218769, LOC100713568
Insert length:
1224 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4853330
$570.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Arylacetamide Deacetylase-Like 4 (AADACL4)
NCBI Accession:
NM_001081248
Species:
Mouse (Murine)
Synonyms:
AADACL4, aadacl4.S, aadacl4, Aadacl4, AADACL4L3, LOC100218769, LOC100713568
Insert length:
1224 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4792071
$570.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Arylacetamide Deacetylase-Like 4 (AADACL4)
NCBI Accession:
NM_001081248
Species:
Mouse (Murine)
Synonyms:
AADACL4, aadacl4.S, aadacl4, Aadacl4, AADACL4L3, LOC100218769, LOC100713568
Insert length:
1224 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4643850
$570.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Arylacetamide Deacetylase-Like 4 (AADACL4)
NCBI Accession:
NM_001081248
Species:
Mouse (Murine)
Synonyms:
AADACL4, aadacl4.S, aadacl4, Aadacl4, AADACL4L3, LOC100218769, LOC100713568
Insert length:
1224 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4724199
$570.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to AADACL4

  • arylacetamide deacetylase like 4 (AADACL4)
  • arylacetamide deacetylase-like 4 S homeolog (aadacl4.S)
  • arylacetamide deacetylase-like 4 (aadacl4)
  • arylacetamide deacetylase-like 4 (Aadacl4)
  • arylacetamide deacetylase-like 4-like 3 (AADACL4L3)
  • arylacetamide deacetylase like 4 (Aadacl4)
  • arylacetamide deacetylase-like 4 (LOC100218769)
  • arylacetamide deacetylase-like 4 (LOC100713568)
  • Aadacl4
  • OTTMUSG00000010747
  • RGD1565761

Gene-IDs for different species

GENE IDSPECIES
343066 Homo sapiens
469815 Pan troglodytes
495387 Xenopus laevis
569798 Danio rerio
715600 Macaca mulatta
100445261 Pongo abelii
313688 Rattus norvegicus
419479 Gallus gallus
435815 Mus musculus
607688 Canis lupus familiaris
100218769 Taeniopygia guttata
100386770 Callithrix jacchus
100599857 Nomascus leucogenys
529424 Bos taurus
100713568 Cavia porcellus
100349449 Oryctolagus cuniculus
100515144 Sus scrofa

Protein level used designations for AADACL4

  • arylacetamide deacetylase-like 4
Other products related to AADACL4 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com