AAGAB (alpha- and gamma-Adaptin Binding Protein, AAGAB)

Short Description: The protein encoded by this gene interacts with the gamma-adaptin and alpha-adaptin subunits of complexes involved in clathrin-coated vesicle trafficking. Mutations in this gene are associated with type I punctate palmoplantar keratoderma. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2012].
More information related to gene AAGAB.
Products related to AAGAB Gene:
  • 78
  • 2
  • 34
  • 25
  • 17
  • 2
  • 1
  • 51
  • 16
  • 16
  • 16
Fusion tag
  • 29
  • 12
  • 10
  • 8
  • 6
Vector Backbone
  • 6
  • 6
  • 6
  • 5
  • 5
  • 33
  • 27
  • 8
  • 6
  • 3
  • 26
  • 22
  • 14
  • 8
  • 6
  • 2
Resistance Gene
  • 39
  • 24
  • 14
  • 2
  • 1
Expression Type
  • 74
  • 42
Selectable Marker
  • 22
  • 20
  • 1
  • 26
  • 24
  • 10
  • 9
  • 8
  • 27
  • 22
  • 16
  • 15
80 Products

alpha- and gamma-Adaptin Binding Protein (AAGAB)
NCBI Accession:
AAGAB, Aagab
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13(-21)
  • M13 rev
Catalog No. ABIN3545830
1 vial
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Protein Expression, Cloning
alpha- and gamma-Adaptin Binding Protein (AAGAB)
Gene ID:
432164 (Xenopus laevis, AAGAB)
AAGAB, Aagab
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3848716
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
alpha- and gamma-Adaptin Binding Protein (AAGAB)
Gene ID:
79719 (Human, AAGAB)
AAGAB, Aagab
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3826746
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
alpha- and gamma-Adaptin Binding Protein (AAGAB)
Gene ID:
79719 (Human, AAGAB)
AAGAB, Aagab
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3826748
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
alpha- and gamma-Adaptin Binding Protein (AAGAB)
Gene ID:
507035 (Cow, AAGAB)
AAGAB, Aagab
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3855194
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
alpha- and gamma-Adaptin Binding Protein (AAGAB)
Gene ID:
66939 (Mouse, AAGAB)
AAGAB, Aagab
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3820683
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression
alpha- and gamma-Adaptin Binding Protein (AAGAB)
Gene ID:
79719 (Human, AAGAB)
AAGAB, Aagab
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3397740
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression
alpha- and gamma-Adaptin Binding Protein (AAGAB)
Gene ID:
79719 (Human, AAGAB)
AAGAB, Aagab
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • pDONR201-forward
Glycerol Stock
-80 °C
Catalog No. ABIN3407958
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression
alpha- and gamma-Adaptin Binding Protein (AAGAB)
Gene ID:
79719 (Human, AAGAB)
AAGAB, Aagab
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • pDONR201-forward
Glycerol Stock
-80 °C
Catalog No. ABIN3407572
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Genome Editing with Engineered Nucleases, Protein Expression
alpha- and gamma-Adaptin Binding Protein (AAGAB)
NCBI Accession:
AAGAB, Aagab
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Aagab
Viral Particles
-80 °C
Catalog No. ABIN5134258
300 μL
Plus shipping costs $45.00 and $24.00 dry ice

Genome Editing with Engineered Nucleases, Protein Expression
alpha- and gamma-Adaptin Binding Protein (AAGAB)
NCBI Accession:
AAGAB, Aagab
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of AAGAB
Viral Particles
-80 °C
Catalog No. ABIN5134256
300 μL
Plus shipping costs $45.00 and $24.00 dry ice

Genome Editing with Engineered Nucleases, Protein Expression
alpha- and gamma-Adaptin Binding Protein (AAGAB)
NCBI Accession:
AAGAB, Aagab
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Aagab
Viral Particles
-80 °C
Catalog No. ABIN5134260
300 μL
Plus shipping costs $45.00 and $24.00 dry ice

Protein Expression
alpha- and gamma-Adaptin Binding Protein (AAGAB)
NCBI Accession:
AAGAB, Aagab
Insert length:
948 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
Catalog No. ABIN3308237
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Protein Expression
alpha- and gamma-Adaptin Binding Protein (AAGAB)
NCBI Accession:
AAGAB, Aagab
Insert length:
2190 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
Catalog No. ABIN3382302
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Protein Expression
alpha- and gamma-Adaptin Binding Protein (AAGAB)
NCBI Accession:
AAGAB, Aagab
Insert length:
948 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5427981
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Protein Expression
alpha- and gamma-Adaptin Binding Protein (AAGAB)
NCBI Accession:
AAGAB, Aagab
Insert length:
621 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5427982
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Protein Expression
alpha- and gamma-Adaptin Binding Protein (AAGAB)
NCBI Accession:
AAGAB, Aagab
Insert length:
621 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5427983
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

RNA Interference
alpha- and gamma-Adaptin Binding Protein
KPPP1, PPKP1, PPKP1A, p34, 2310007F21Rik, P34
HPLC purified
Available with shipment
  • 2310007F21Rik (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
-20 °C
Catalog No. ABIN3272718
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

RNA Interference
alpha- and gamma-Adaptin Binding Protein
KPPP1, PPKP1, PPKP1A, p34, 2310007F21Rik, P34
HPLC purified
Available with shipment
  • AAGAB (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
-20 °C
Catalog No. ABIN3288577
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Protein Expression
alpha- and gamma-Adaptin Binding Protein (AAGAB)
Gene ID:
79719 (Human, AAGAB)
AAGAB, Aagab
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter
Fusion Tag:
V5 tag
Stable, Transient

Sequencing Primer:
  • 3-1291
Glycerol Stock
-80 °C
Catalog No. ABIN3398880
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
  • <
  • 1

Synonyms and alternative names related to AAGAB

  • alpha and gamma adaptin binding protein (AAGAB)
  • alpha- and gamma-adaptin binding protein (Aagab)
  • 2310007F21Rik
  • KPPP1
  • p34
  • P34
  • PPKP1
  • PPKP1A

Gene-IDs for different species

79719 Homo sapiens
66939 Mus musculus
171435 Rattus norvegicus
100171638 Pongo abelii

Protein level used designations for AAGAB

  • alpha- and gamma-adaptin-binding protein p34
Other products related to AAGAB such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com