AAGAB (alpha- and gamma-Adaptin Binding Protein, AAGAB)

Short Description: The protein encoded by this gene interacts with the gamma-adaptin and alpha-adaptin subunits of complexes involved in clathrin-coated vesicle trafficking. Mutations in this gene are associated with type I punctate palmoplantar keratoderma. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2012].
More information related to gene AAGAB.
Products related to AAGAB Gene:
91 Products
Type
  • 86
  • 5
Species
  • 38
  • 28
  • 19
  • 2
  • 2
Oligo-Type
  • 5
Insert
  • 31
  • 22
  • 17
  • 8
  • 6
Vector
  • 35
  • 33
  • 8
  • 6
  • 3
Vector Backbone
  • 10
  • 6
  • 6
  • 6
  • 5
Fusion tag
  • 37
  • 15
  • 10
  • 8
  • 6
Resistance Gene
  • 44
  • 27
  • 14
  • 2
  • 1
Selectable Marker
  • 23
  • 22
  • 1
Promoter
  • 29
  • 27
  • 15
  • 9
  • 8
Expression Type
  • 82
  • 45
Application
  • 56
  • 22
  • 21
  • 16
Format
  • 33
  • 22
  • 20
  • 16
Supplier: Log in to see

Full length Clone DNA of Homo sapiens alpha- and gamma-adaptin binding protein

Type:
cDNA
Application:
Cloning
Gene:
alpha- and gamma-Adaptin Binding Protein (AAGAB)
NCBI Accession:
NM_001271886
Species:
Human
Synonyms:
AAGAB, Aagab
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3545830
€66.37
1 vial
Plus shipping costs €45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Mus musculus alpha- and gamma-adaptin binding protein cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
alpha- and gamma-Adaptin Binding Protein (AAGAB)
Gene ID:
66939 (Mouse (Murine), AAGAB)
Synonyms:
AAGAB, Aagab
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3820682
€97.35
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Homo sapiens alpha- and gamma-adaptin binding protein cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
alpha- and gamma-Adaptin Binding Protein (AAGAB)
Gene ID:
79719 (Human, AAGAB)
Synonyms:
AAGAB, Aagab
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3826749
€97.35
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Homo sapiens alpha- and gamma-adaptin binding protein cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
alpha- and gamma-Adaptin Binding Protein (AAGAB)
Gene ID:
79719 (Human, AAGAB)
Synonyms:
AAGAB, Aagab
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3826747
€97.35
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Xenopus laevis alpha- and gamma-adaptin binding protein cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
alpha- and gamma-Adaptin Binding Protein (AAGAB)
Gene ID:
432164 (Xenopus laevis, AAGAB)
Synonyms:
AAGAB, Aagab
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3848715
€97.35
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Bos taurus alpha- and gamma-adaptin binding protein cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
alpha- and gamma-Adaptin Binding Protein (AAGAB)
Gene ID:
507035 (Cow (Bovine), AAGAB)
Synonyms:
AAGAB, Aagab
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3855196
€97.35
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Mus musculus alpha- and gamma-adaptin binding protein cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
alpha- and gamma-Adaptin Binding Protein (AAGAB)
Gene ID:
66939 (Mouse (Murine), AAGAB)
Synonyms:
AAGAB, Aagab
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3820683
€136.67
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens alpha- and gamma-adaptin binding protein cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
alpha- and gamma-Adaptin Binding Protein (AAGAB)
Gene ID:
79719 (Human, AAGAB)
Synonyms:
AAGAB, Aagab
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3826748
€136.67
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens alpha- and gamma-adaptin binding protein cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
alpha- and gamma-Adaptin Binding Protein (AAGAB)
Gene ID:
79719 (Human, AAGAB)
Synonyms:
AAGAB, Aagab
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3826746
€136.67
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Bos taurus alpha- and gamma-adaptin binding protein cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
alpha- and gamma-Adaptin Binding Protein (AAGAB)
Gene ID:
507035 (Cow (Bovine), AAGAB)
Synonyms:
AAGAB, Aagab
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3855194
€136.67
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Xenopus laevis alpha- and gamma-adaptin binding protein cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
alpha- and gamma-Adaptin Binding Protein (AAGAB)
Gene ID:
432164 (Xenopus laevis, AAGAB)
Synonyms:
AAGAB, Aagab
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3848716
€136.67
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human AAGAB is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
alpha- and gamma-Adaptin Binding Protein (AAGAB)
NCBI Accession:
NM_024666,NP_078942
Species:
Human
Synonyms:
AAGAB, Aagab
Insert length:
2190 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3382302
€168.14
10 μg
Plus shipping costs €45.00
Delivery in 8 to 11 Business Days
Supplier: Log in to see

The alpha- and gamma-adaptin binding protein ORF clone is provided in a Gateway adapted entry vector for fast and convenient transfer to any compatible expression vector.

Type:
ORF
Application:
Protein Expression
Gene:
alpha- and gamma-Adaptin Binding Protein (AAGAB)
Gene ID:
79719 (Human, AAGAB)
Synonyms:
AAGAB, Aagab
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3397740
€265.49
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

The alpha- and gamma-adaptin binding protein ORF clone is provided in a Gateway adapted entry vector for fast and convenient transfer to any compatible expression vector.

Type:
ORF
Application:
Protein Expression
Gene:
alpha- and gamma-Adaptin Binding Protein (AAGAB)
Gene ID:
79719 (Human, AAGAB)
Synonyms:
AAGAB, Aagab
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR201
Resistance Gene:
Kanamycin

Sequencing Primer:
  • pDONR201-forward
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3407572
€265.49
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

The alpha- and gamma-adaptin binding protein ORF clone is provided in a Gateway adapted entry vector for fast and convenient transfer to any compatible expression vector.

Type:
ORF
Application:
Protein Expression
Gene:
alpha- and gamma-Adaptin Binding Protein (AAGAB)
Gene ID:
79719 (Human, AAGAB)
Synonyms:
AAGAB, Aagab
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR201
Resistance Gene:
Kanamycin

Sequencing Primer:
  • pDONR201-forward
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3407958
€265.49
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Rat Aagab is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
alpha- and gamma-Adaptin Binding Protein (AAGAB)
NCBI Accession:
NM_134398,NP_599225
Species:
Rat (Rattus)
Synonyms:
AAGAB, Aagab
Insert length:
948 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3308237
€345.13
10 μg
Plus shipping costs €45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

siRNA (27 mer) kit with 3 gene-specific unique siRNA duplexes and negative control for gene knockdown.

Application:
RNA Interference
Gene:
alpha- and gamma-Adaptin Binding Protein
Species:
Mouse (Murine)
Synonyms:
KPPP1, PPKP1, PPKP1A, p34, 2310007F21Rik, P34
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • 2310007F21Rik (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3272718
€345.13
1 kit
Plus shipping costs €45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

siRNA (27 mer) kit with 3 gene-specific unique siRNA duplexes and negative control for gene knockdown.

Application:
RNA Interference
Gene:
alpha- and gamma-Adaptin Binding Protein
Species:
Human
Synonyms:
KPPP1, PPKP1, PPKP1A, p34, 2310007F21Rik, P34
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • AAGAB (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3288577
€345.13
1 kit
Plus shipping costs €45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Individual gRNA against AAGAB in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
alpha- and gamma-Adaptin Binding Protein (AAGAB)
NCBI Accession:
NM_024666
Species:
Human
Synonyms:
AAGAB, Aagab
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of AAGAB
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5134256
€349.56
300 μL
Plus shipping costs €45.00 and €20.00 dry ice
Available
Supplier: Log in to see

Individual gRNA against Aagab in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
alpha- and gamma-Adaptin Binding Protein (AAGAB)
NCBI Accession:
NM_025857
Species:
Mouse (Murine)
Synonyms:
AAGAB, Aagab
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Aagab
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5134258
€349.56
300 μL
Plus shipping costs €45.00 and €20.00 dry ice
Available
  • <
  • 1

Synonyms and alternative names related to AAGAB

  • alpha and gamma adaptin binding protein (AAGAB)
  • alpha- and gamma-adaptin binding protein (Aagab)
  • 2310007F21Rik
  • KPPP1
  • p34
  • P34
  • PPKP1
  • PPKP1A

Gene-IDs for different species

GENE IDSPECIES
79719 Homo sapiens
66939 Mus musculus
171435 Rattus norvegicus
100171638 Pongo abelii

Protein level used designations for AAGAB

  • alpha- and gamma-adaptin-binding protein p34
Other products related to AAGAB such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com