AAK1 (AAK1, )

Short Description: Adaptor-related protein complex 2 (AP-2 complexes) functions during receptor-mediated endocytosis to trigger clathrin assembly, interact with membrane-bound receptors, and recruit encodytic accessory factors. This gene encodes a member of the SNF1 subfamily of Ser/Thr protein kinases. The protein interacts with and phosphorylates a subunit of the AP-2 complex, which promotes binding of AP-2 to sorting signals found in membrane-bound receptors and subsequent receptor endocytosis. Its kinase activity is stimulated by clathrin. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008].
More information related to gene AAK1.
Products related to AAK1 Gene:
  • 93
  • 2
  • 41
  • 34
  • 17
  • 3
  • 48
  • 28
  • 16
  • 16
Fusion tag
  • 33
  • 12
  • 10
  • 9
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 5
  • 5
  • 32
  • 28
  • 16
  • 10
  • 6
  • 44
  • 19
  • 14
  • 8
  • 6
  • 2
Resistance Gene
  • 40
  • 34
  • 14
  • 5
  • 2
Expression Type
  • 86
  • 46
  • 1
Selectable Marker
  • 32
  • 22
  • 1
  • 30
  • 24
  • 18
  • 8
  • 8
  • 36
  • 28
  • 20
  • 11
95 Products

AAK1, Aak1, LOC100512341, aak1b
Insert length:
1425 bp
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5737398
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Gene ID:
22848 (Human)
AAK1, Aak1, LOC100512341, aak1b
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4004226
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Gene ID:
22848 (Human)
AAK1, Aak1, LOC100512341, aak1b
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4004227
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Gene ID:
22848 (Human)
AAK1, Aak1, LOC100512341, aak1b
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4004228
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Gene ID:
100135375 (Xenopus tropicalis)
AAK1, Aak1, LOC100512341, aak1b
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4026427
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Gene ID:
100135375 (Xenopus tropicalis)
AAK1, Aak1, LOC100512341, aak1b
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4026428
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Gene ID:
269774 (Mouse)
AAK1, Aak1, LOC100512341, aak1b
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3998070
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Gene ID:
22848 (Human)
AAK1, Aak1, LOC100512341, aak1b
Insert length:
1423 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
2 μg of lyophilized gene in pDONR223 vector
-20 °C
Catalog No. ABIN5318423
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

AAK1, Aak1, LOC100512341, aak1b
Insert length:
1425 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4696759
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

AAK1, Aak1, LOC100512341, aak1b
Insert length:
1425 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4825888
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

AAK1, Aak1, LOC100512341, aak1b
Insert length:
1425 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4372099
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

AAK1, Aak1, LOC100512341, aak1b
Insert length:
1425 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4758007
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Protein Expression
AAK1, Aak1, LOC100512341, aak1b
Insert length:
1425 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
HA tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4372530
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Protein Expression
AAK1, Aak1, LOC100512341, aak1b
Insert length:
1425 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
His tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4432727
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Genome Editing with Engineered Nucleases, Protein Expression
NCBI Accession:
AAK1, Aak1, LOC100512341, aak1b
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Aak1
Viral Particles
-80 °C
Catalog No. ABIN5112894
300 μL
Plus shipping costs $45.00 and $24.00 dry ice

Genome Editing with Engineered Nucleases, Protein Expression
NCBI Accession:
AAK1, Aak1, LOC100512341, aak1b
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of AAK1
Viral Particles
-80 °C
Catalog No. ABIN5112890
300 μL
Plus shipping costs $45.00 and $24.00 dry ice

Genome Editing with Engineered Nucleases, Protein Expression
NCBI Accession:
AAK1, Aak1, LOC100512341, aak1b
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Aak1
Viral Particles
-80 °C
Catalog No. ABIN5112892
300 μL
Plus shipping costs $45.00 and $24.00 dry ice

Protein Expression
AAK1, Aak1, LOC100512341, aak1b
Insert length:
1650 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
Catalog No. ABIN3380838
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

RNA Interference
5530400K14Rik, 9630042K20, AU067724, AU067726, BC028270, C79663, D6Ertd245e, R75501, mKIAA1048, RGD1563580, aak1, si:dkey-261l11.5
HPLC purified
Available with shipment
  • Aak1 (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
-20 °C
Catalog No. ABIN3348300
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

RNA Interference
5530400K14Rik, 9630042K20, AU067724, AU067726, BC028270, C79663, D6Ertd245e, R75501, mKIAA1048, RGD1563580, aak1, si:dkey-261l11.5
HPLC purified
Available with shipment
  • AAK1 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
-20 °C
Catalog No. ABIN3283857
1 kit
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days
  • <
  • 1

Synonyms and alternative names related to AAK1

  • AP2 associated kinase 1 (AAK1)
  • AP2 associated kinase 1 (Aak1)
  • uncharacterized protein FLJ45252 (LOC100512341)
  • AP2 associated kinase 1b (aak1b)
  • 5530400K14Rik
  • 9630042K20
  • aak1
  • AU067724
  • AU067726
  • BC028270
  • C79663
  • D6Ertd245e
  • mKIAA1048
  • R75501
  • RGD1563580
  • si:dkey-261l11.5

Gene-IDs for different species

22848 Homo sapiens
269774 Mus musculus
500244 Rattus norvegicus
532546 Bos taurus
100512341 Sus scrofa
100534954 Danio rerio
100727491 Cavia porcellus
419512 Gallus gallus

Protein level used designations for AAK1

  • AP2-associated protein kinase 1
  • adaptor-associated kinase 1
  • AP2 associated kinase 1
Other products related to AAK1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com