AAK1 (AAK1, )

Short Description: Adaptor-related protein complex 2 (AP-2 complexes) functions during receptor-mediated endocytosis to trigger clathrin assembly, interact with membrane-bound receptors, and recruit encodytic accessory factors. This gene encodes a member of the SNF1 subfamily of Ser/Thr protein kinases. The protein interacts with and phosphorylates a subunit of the AP-2 complex, which promotes binding of AP-2 to sorting signals found in membrane-bound receptors and subsequent receptor endocytosis. Its kinase activity is stimulated by clathrin. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008].
More information related to gene AAK1.
Products related to AAK1 Gene:
106 Products
Type
  • 102
  • 4
Species
  • 44
  • 39
  • 17
  • 6
Oligo-Type
  • 4
Insert
  • 51
  • 19
  • 16
  • 8
  • 6
Vector
  • 32
  • 31
  • 16
  • 16
  • 6
Vector Backbone
  • 10
  • 6
  • 6
  • 6
  • 5
Fusion tag
  • 42
  • 12
  • 12
  • 9
  • 8
Resistance Gene
  • 43
  • 40
  • 14
  • 5
  • 2
Selectable Marker
  • 39
  • 22
  • 2
Promoter
  • 32
  • 26
  • 18
  • 9
  • 8
Expression Type
  • 89
  • 48
  • 2
Application
  • 49
  • 35
  • 20
  • 16
Format
  • 36
  • 32
  • 20
  • 18
Supplier: Log in to see

ORF Cloning-Vector holds the gene between an AflII and EcoRV cut site.

Type:
ORF
Application:
Cloning
Gene:
AAK1
Species:
Human
Synonyms:
AAK1, Aak1, LOC100512341, aak1b
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5737398
$45.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Full length Xenopus tropicalis AP2 associated kinase 1 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
AAK1
Gene ID:
100135375 (Xenopus tropicalis)
Synonyms:
AAK1, Aak1, LOC100512341, aak1b
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4026426
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Xenopus tropicalis AP2 associated kinase 1 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
AAK1
Gene ID:
100135375 (Xenopus tropicalis)
Synonyms:
AAK1, Aak1, LOC100512341, aak1b
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4026425
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Homo sapiens AP2 associated kinase 1 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
AAK1
Gene ID:
22848 (Human)
Synonyms:
AAK1, Aak1, LOC100512341, aak1b
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4004230
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Homo sapiens AP2 associated kinase 1 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
AAK1
Gene ID:
22848 (Human)
Synonyms:
AAK1, Aak1, LOC100512341, aak1b
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4004225
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Homo sapiens AP2 associated kinase 1 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
AAK1
Gene ID:
22848 (Human)
Synonyms:
AAK1, Aak1, LOC100512341, aak1b
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4004229
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Mus musculus AP2 associated kinase 1 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
AAK1
Gene ID:
269774 (Mouse (Murine))
Synonyms:
AAK1, Aak1, LOC100512341, aak1b
Vector type:
Cloning Vector
Vector backbone:
pCR-XL-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3998069
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Xenopus tropicalis AP2 associated kinase 1 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
AAK1
Gene ID:
100135375 (Xenopus tropicalis)
Synonyms:
AAK1, Aak1, LOC100512341, aak1b
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4026427
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Xenopus tropicalis AP2 associated kinase 1 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
AAK1
Gene ID:
100135375 (Xenopus tropicalis)
Synonyms:
AAK1, Aak1, LOC100512341, aak1b
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4026428
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens AP2 associated kinase 1 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
AAK1
Gene ID:
22848 (Human)
Synonyms:
AAK1, Aak1, LOC100512341, aak1b
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4004226
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens AP2 associated kinase 1 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
AAK1
Gene ID:
22848 (Human)
Synonyms:
AAK1, Aak1, LOC100512341, aak1b
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4004228
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens AP2 associated kinase 1 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
AAK1
Gene ID:
22848 (Human)
Synonyms:
AAK1, Aak1, LOC100512341, aak1b
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4004227
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Mus musculus AP2 associated kinase 1 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
AAK1
Gene ID:
269774 (Mouse (Murine))
Synonyms:
AAK1, Aak1, LOC100512341, aak1b
Vector type:
Cloning Vector
Vector backbone:
pCR-XL-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3998070
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human AAK1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
AAK1
Species:
Human
Synonyms:
AAK1, Aak1, LOC100512341, aak1b
Insert length:
1650 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948183

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3380838
$190.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 11 Business Days
Supplier: Log in to see

Entry clone of human cDNA (ORF) without STOP codon in Gateway pDONR223 Vector.

Type:
ORF
Application:
Cloning
Gene:
AAK1
Gene ID:
22848 (Human)
Synonyms:
AAK1, Aak1, LOC100512341, aak1b
Insert length:
1423 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5318423
$194.53
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
Supplier: Log in to see

Bacterial expression of Human AAK1 with His-MBP

Type:
cDNA
Application:
Cloning
Gene:
AAK1
Species:
Human
Synonyms:
AAK1, Aak1, LOC100512341, aak1b
Insert length:
1425 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4696759
$275.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Human AAK1 with His tag

Type:
cDNA
Application:
Cloning
Gene:
AAK1
Species:
Human
Synonyms:
AAK1, Aak1, LOC100512341, aak1b
Insert length:
1425 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4758007
$275.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Human AAK1 with His-GST

Type:
cDNA
Application:
Cloning
Gene:
AAK1
Species:
Human
Synonyms:
AAK1, Aak1, LOC100512341, aak1b
Insert length:
1425 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4825888
$275.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Mammalian expression of Human AAK1 with HA tag

Type:
cDNA
Application:
Protein Expression
Gene:
AAK1
Species:
Human
Synonyms:
AAK1, Aak1, LOC100512341, aak1b
Insert length:
1425 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4372530
$275.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Human AAK1 with His tag

Type:
cDNA
Application:
Cloning
Gene:
AAK1
Species:
Human
Synonyms:
AAK1, Aak1, LOC100512341, aak1b
Insert length:
1425 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4372099
$275.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to AAK1

  • AP2 associated kinase 1 (AAK1)
  • AP2 associated kinase 1 (Aak1)
  • uncharacterized protein FLJ45252 (LOC100512341)
  • AP2 associated kinase 1b (aak1b)
  • 5530400K14Rik
  • 9630042K20
  • aak1
  • AU067724
  • AU067726
  • BC028270
  • C79663
  • D6Ertd245e
  • mKIAA1048
  • R75501
  • RGD1563580
  • si:dkey-261l11.5

Gene-IDs for different species

GENE IDSPECIES
22848 Homo sapiens
269774 Mus musculus
500244 Rattus norvegicus
532546 Bos taurus
100512341 Sus scrofa
100534954 Danio rerio
100727491 Cavia porcellus
419512 Gallus gallus

Protein level used designations for AAK1

  • AP2-associated protein kinase 1
  • adaptor-associated kinase 1
  • AP2 associated kinase 1
Other products related to AAK1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com