AARD (Alanine and Arginine Rich Domain Containing Protein, AARD)

Products related to AARD Gene:
88 Products
  • 82
  • 6
  • 30
  • 30
  • 28
  • 6
  • 33
  • 19
  • 14
  • 8
  • 6
  • 31
  • 23
  • 12
  • 9
  • 7
Vector Backbone
  • 6
  • 6
  • 5
  • 5
  • 4
Fusion tag
  • 33
  • 14
  • 9
  • 8
  • 6
Resistance Gene
  • 34
  • 27
  • 18
  • 3
  • 2
Selectable Marker
  • 26
  • 24
  • 31
  • 26
  • 12
  • 8
  • 7
Expression Type
  • 78
  • 45
  • 40
  • 25
  • 21
  • 16
  • 31
  • 27
  • 21
  • 9
Supplier: Log in to see

Full length Homo sapiens alanine and arginine rich domain containing protein cDNA clone.

Alanine and Arginine Rich Domain Containing Protein (AARD)
Gene ID:
441376 (Human, AARD)
AARD, Aard
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4020827
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Mus musculus alanine and arginine rich domain containing protein cDNA clone.

Alanine and Arginine Rich Domain Containing Protein (AARD)
Gene ID:
239435 (Mouse (Murine), AARD)
AARD, Aard
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • M13(-21)
Glycerol Stock
-80 °C
Catalog No. ABIN4040057
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Homo sapiens alanine and arginine rich domain containing protein cDNA clone.

Protein Expression, Cloning
Alanine and Arginine Rich Domain Containing Protein (AARD)
Gene ID:
441376 (Human, AARD)
AARD, Aard
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3849087
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens alanine and arginine rich domain containing protein cDNA clone.

Alanine and Arginine Rich Domain Containing Protein (AARD)
Gene ID:
441376 (Human, AARD)
AARD, Aard
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4020828
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Mus musculus alanine and arginine rich domain containing protein cDNA clone.

Alanine and Arginine Rich Domain Containing Protein (AARD)
Gene ID:
239435 (Mouse (Murine), AARD)
AARD, Aard
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • M13(-21)
Glycerol Stock
-80 °C
Catalog No. ABIN4040058
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens alanine and arginine rich domain containing protein cDNA clone.

Protein Expression, Cloning
Alanine and Arginine Rich Domain Containing Protein (AARD)
Gene ID:
441376 (Human, AARD)
AARD, Aard
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3849086
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

ORF Cloning-Vector holds the gene between an AflII and EcoRV cut site.

Alanine and Arginine Rich Domain Containing Protein (AARD)
NCBI Accession:
AARD, Aard
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5767296
1 μg
Plus shipping costs €45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

siRNA (27 mer) kit with 3 gene-specific unique siRNA duplexes and negative control for gene knockdown.

RNA Interference
Alanine and Arginine Rich Domain Containing Protein
C8orf85, A5D3, AV328152
HPLC purified
Available with shipment
  • AARD (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
-20 °C
Catalog No. ABIN3273416
1 kit
Plus shipping costs €45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human AARD is ideal for over-expression of native protein for functional studies.

Protein Expression
Alanine and Arginine Rich Domain Containing Protein (AARD)
NCBI Accession:
AARD, Aard
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
Catalog No. ABIN3320527
10 μg
Plus shipping costs €45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

siRNA (27 mer) kit with 3 gene-specific unique siRNA duplexes and negative control for gene knockdown.

RNA Interference
Alanine and Arginine Rich Domain Containing Protein
Rat (Rattus)
C8orf85, A5D3, AV328152
HPLC purified
Available with shipment
  • Aard (Rat) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
-20 °C
Catalog No. ABIN3355730
1 kit
Plus shipping costs €45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Rat Aard is ideal for over-expression of native protein for functional studies.

Protein Expression
Alanine and Arginine Rich Domain Containing Protein (AARD)
NCBI Accession:
Rat (Rattus)
AARD, Aard
Insert length:
498 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
Catalog No. ABIN3308251
10 μg
Plus shipping costs €45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Aard is ideal for over-expression of native protein for functional studies.

Protein Expression
Alanine and Arginine Rich Domain Containing Protein (AARD)
NCBI Accession:
Mouse (Murine)
AARD, Aard
Insert length:
504 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
Catalog No. ABIN3308250
10 μg
Plus shipping costs €45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

siRNA (27 mer) kit with 3 gene-specific unique siRNA duplexes and negative control for gene knockdown.

RNA Interference
Alanine and Arginine Rich Domain Containing Protein
Mouse (Murine)
C8orf85, A5D3, AV328152
HPLC purified
Available with shipment
  • Aard (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
-20 °C
Catalog No. ABIN3277825
1 kit
Plus shipping costs €45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Individual gRNA against C8orf85 in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Genome Editing with Engineered Nucleases, Protein Expression
Alanine and Arginine Rich Domain Containing Protein (AARD)
NCBI Accession:
AARD, Aard
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of C8orf85
Viral Particles
-80 °C
Catalog No. ABIN5171590
300 μL
Plus shipping costs €45.00 and €20.00 dry ice
Supplier: Log in to see

Individual gRNA against Aard in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Genome Editing with Engineered Nucleases, Protein Expression
Alanine and Arginine Rich Domain Containing Protein (AARD)
NCBI Accession:
Mouse (Murine)
AARD, Aard
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Aard
Viral Particles
-80 °C
Catalog No. ABIN5171592
300 μL
Plus shipping costs €45.00 and €20.00 dry ice
Supplier: Log in to see

Individual gRNA against Aard in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Genome Editing with Engineered Nucleases, Protein Expression
Alanine and Arginine Rich Domain Containing Protein (AARD)
NCBI Accession:
Rat (Rattus)
AARD, Aard
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Aard
Viral Particles
-80 °C
Catalog No. ABIN5171594
300 μL
Plus shipping costs €45.00 and €20.00 dry ice
Supplier: Log in to see

Mammalian Vector with ORF clone of Rat alanine and arginine rich domain containing protein (Aard)

Protein Expression
Alanine and Arginine Rich Domain Containing Protein (AARD)
NCBI Accession:
Rat (Rattus)
AARD, Aard
Insert length:
498 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5486638
10 μg
Plus shipping costs €45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

ORF Cloning-Vector holds the gene between an AflII and EcoRV cut site.

Alanine and Arginine Rich Domain Containing Protein (AARD)
NCBI Accession:
Mouse (Murine)
AARD, Aard
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5767294
1 μg
Plus shipping costs €45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

ORF Cloning-Vector holds the gene between an AflII and EcoRV cut site.

Alanine and Arginine Rich Domain Containing Protein (AARD)
NCBI Accession:
Rat (Rattus)
AARD, Aard
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5767295
1 μg
Plus shipping costs €45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

siRNA to inhibit AARD expression using RNA interference.

RNA Interference
Alanine and Arginine Rich Domain Containing Protein
Gene ID:
441376 (Human, AARD)
C8orf85, A5D3, AV328152
Oligonucleotide synthesis is monitored base by base through trityl analysis to ensure appropriate coupling efficiency. The oligo is subsequently purified by affinity-solid phase extraction. The annealed RNA duplex is further analyzed by mass spectrometry to verify the exact composition of the duplex. Each lot is compared to the previous lot by mass spectrometry to ensure maximum lot-to-lot consistency.
This product is provided as two 5 nmol vials (10 nmol), three 5 nmol vials (15 nmol) or 2x three 5 nmol vials (30 nmol) of lyophilized siRNA oligo duplexes. Each vial contains slightly different sequences to ensure full knockout of the gene. Each vial contains slightly different sequences to ensure full knockout of the gene. The duplexes can be transfected individually or pooled together to achieve knockdown of the target gene, which is most commonly assessed by qPCR or western blot. The siRNA oligos are also chemically modified (2'-OMe) for increased stability and enhanced knockdown in vitro and in vivo.
-20 °C
Catalog No. ABIN5803062
15 nmol
Plus shipping costs €45.00
Delivery in 16 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to AARD

  • alanine and arginine rich domain containing protein (AARD)
  • alanine and arginine rich domain containing protein (Aard)
  • A5D3
  • AV328152
  • C8orf85

Gene-IDs for different species

441376 Homo sapiens
239435 Mus musculus
246323 Rattus norvegicus

Protein level used designations for AARD

  • alanine and arginine-rich domain-containing protein
  • rA5D3
Other products related to AARD such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com