AARD (Alanine and Arginine Rich Domain Containing Protein, AARD)

Products related to AARD Gene:
88 Products
Type
  • 82
  • 6
Species
  • 30
  • 30
  • 28
Application
  • 40
  • 25
  • 21
  • 16
Fusion tag
  • 33
  • 14
  • 9
  • 8
  • 6
Vector Backbone
  • 6
  • 6
  • 5
  • 5
  • 4
Vector
  • 31
  • 23
  • 12
  • 9
  • 7
Insert
  • 33
  • 19
  • 14
  • 8
  • 6
Oligo-Type
  • 6
Resistance Gene
  • 34
  • 27
  • 18
  • 3
  • 2
Expression Type
  • 78
  • 45
Selectable Marker
  • 26
  • 24
Promoter
  • 31
  • 26
  • 12
  • 8
  • 7
Format
  • 31
  • 27
  • 21
  • 9
Supplier: Log in to see

Full length Mus musculus alanine and arginine rich domain containing protein cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Alanine and Arginine Rich Domain Containing Protein (AARD)
Gene ID:
239435 (Mouse (Murine), AARD)
Synonyms:
AARD, Aard
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4040057
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Homo sapiens alanine and arginine rich domain containing protein cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Alanine and Arginine Rich Domain Containing Protein (AARD)
Gene ID:
441376 (Human, AARD)
Synonyms:
AARD, Aard
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4020827
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Homo sapiens alanine and arginine rich domain containing protein cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Alanine and Arginine Rich Domain Containing Protein (AARD)
Gene ID:
441376 (Human, AARD)
Synonyms:
AARD, Aard
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3849087
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Mus musculus alanine and arginine rich domain containing protein cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Alanine and Arginine Rich Domain Containing Protein (AARD)
Gene ID:
239435 (Mouse (Murine), AARD)
Synonyms:
AARD, Aard
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4040058
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens alanine and arginine rich domain containing protein cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Alanine and Arginine Rich Domain Containing Protein (AARD)
Gene ID:
441376 (Human, AARD)
Synonyms:
AARD, Aard
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4020828
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens alanine and arginine rich domain containing protein cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Alanine and Arginine Rich Domain Containing Protein (AARD)
Gene ID:
441376 (Human, AARD)
Synonyms:
AARD, Aard
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3849086
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

ORF Cloning-Vector holds the gene between an AflII and EcoRV cut site.

Type:
ORF
Application:
Cloning
Gene:
Alanine and Arginine Rich Domain Containing Protein (AARD)
NCBI Accession:
NM_001025357
Species:
Human
Synonyms:
AARD, Aard
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5767296
$375.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Rat Aard is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Alanine and Arginine Rich Domain Containing Protein (AARD)
NCBI Accession:
NM_145093,NP_659561
Species:
Rat (Rattus)
Synonyms:
AARD, Aard
Insert length:
498 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3308251
$410.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Mammalian Vector with ORF clone of Rat alanine and arginine rich domain containing protein (Aard)

Type:
ORF
Application:
Protein Expression
Gene:
Alanine and Arginine Rich Domain Containing Protein (AARD)
NCBI Accession:
NM_145093,NP_659561
Species:
Rat (Rattus)
Synonyms:
AARD, Aard
Insert length:
498 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5486638
$410.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human AARD is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Alanine and Arginine Rich Domain Containing Protein (AARD)
NCBI Accession:
NM_001025357,NP_001020528
Species:
Human
Synonyms:
AARD, Aard
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3320527
$410.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Aard is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Alanine and Arginine Rich Domain Containing Protein (AARD)
NCBI Accession:
NM_175503,NP_780712
Species:
Mouse (Murine)
Synonyms:
AARD, Aard
Insert length:
504 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3308250
$410.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Individual gRNA against Aard in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Alanine and Arginine Rich Domain Containing Protein (AARD)
NCBI Accession:
NM_175503
Species:
Mouse (Murine)
Synonyms:
AARD, Aard
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Aard
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5171592
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
Supplier: Log in to see

Individual gRNA against C8orf85 in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Alanine and Arginine Rich Domain Containing Protein (AARD)
NCBI Accession:
NM_001025357
Species:
Human
Synonyms:
AARD, Aard
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of C8orf85
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5171590
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
Supplier: Log in to see

Individual gRNA against Aard in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Alanine and Arginine Rich Domain Containing Protein (AARD)
NCBI Accession:
NM_145093
Species:
Rat (Rattus)
Synonyms:
AARD, Aard
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Aard
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5171594
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
Supplier: Log in to see

siRNA (27 mer) kit with 3 gene-specific unique siRNA duplexes and negative control for gene knockdown.

Application:
RNA Interference
Gene:
Alanine and Arginine Rich Domain Containing Protein
Species:
Human
Synonyms:
C8orf85, A5D3, AV328152
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • AARD (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3273416
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

siRNA (27 mer) kit with 3 gene-specific unique siRNA duplexes and negative control for gene knockdown.

Application:
RNA Interference
Gene:
Alanine and Arginine Rich Domain Containing Protein
Species:
Rat (Rattus)
Synonyms:
C8orf85, A5D3, AV328152
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Aard (Rat) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3355730
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

siRNA (27 mer) kit with 3 gene-specific unique siRNA duplexes and negative control for gene knockdown.

Application:
RNA Interference
Gene:
Alanine and Arginine Rich Domain Containing Protein
Species:
Mouse (Murine)
Synonyms:
C8orf85, A5D3, AV328152
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Aard (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3277825
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

ORF Cloning-Vector holds the gene between an AflII and EcoRV cut site.

Type:
ORF
Application:
Cloning
Gene:
Alanine and Arginine Rich Domain Containing Protein (AARD)
NCBI Accession:
NM_145093
Species:
Rat (Rattus)
Synonyms:
AARD, Aard
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5767295
$475.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

ORF Cloning-Vector holds the gene between an AflII and EcoRV cut site.

Type:
ORF
Application:
Cloning
Gene:
Alanine and Arginine Rich Domain Containing Protein (AARD)
NCBI Accession:
NM_175503
Species:
Mouse (Murine)
Synonyms:
AARD, Aard
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5767294
$475.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

siRNA to inhibit AARD expression using RNA interference.

Application:
RNA Interference
Gene:
Alanine and Arginine Rich Domain Containing Protein
Gene ID:
246323 (Rat (Rattus), AARD)
Synonyms:
C8orf85, A5D3, AV328152
Purification:
Oligonucleotide synthesis is monitored base by base through trityl analysis to ensure appropriate coupling efficiency. The oligo is subsequently purified by affinity-solid phase extraction. The annealed RNA duplex is further analyzed by mass spectrometry to verify the exact composition of the duplex. Each lot is compared to the previous lot by mass spectrometry to ensure maximum lot-to-lot consistency.
Components:
This product is provided as two 5 nmol vials (10 nmol), three 5 nmol vials (15 nmol) or 2x three 5 nmol vials (30 nmol) of lyophilized siRNA oligo duplexes. Each vial contains slightly different sequences to ensure full knockout of the gene. Each vial contains slightly different sequences to ensure full knockout of the gene. The duplexes can be transfected individually or pooled together to achieve knockdown of the target gene, which is most commonly assessed by qPCR or western blot. The siRNA oligos are also chemically modified (2'-OMe) for increased stability and enhanced knockdown in vitro and in vivo.
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5803063
$516.85
Plus shipping costs $45.00
Delivery in 16 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to AARD

  • alanine and arginine rich domain containing protein (AARD)
  • alanine and arginine rich domain containing protein (Aard)
  • A5D3
  • AV328152
  • C8orf85

Gene-IDs for different species

GENE IDSPECIES
441376 Homo sapiens
239435 Mus musculus
246323 Rattus norvegicus

Protein level used designations for AARD

  • alanine and arginine-rich domain-containing protein
  • rA5D3
Other products related to AARD such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com