AATF (Apoptosis Antagonizing Transcription Factor, AATF)

Short Description: The protein encoded by this gene was identified on the basis of its interaction with MAP3K12/DLK, a protein kinase known to be involved in the induction of cell apoptosis. This gene product contains a leucine zipper, which is a characteristic motif of transcription factors, and was shown to exhibit strong transactivation activity when fused to Gal4 DNA binding domain. Overexpression of this gene interfered with MAP3K12 induced apoptosis. [provided by RefSeq, Jul 2008].
More information related to gene AATF.
Products related to AATF Gene:
109 Products
Type
  • 103
  • 6
Species
  • 39
  • 31
  • 29
  • 6
  • 2
Application
  • 55
  • 33
  • 27
  • 16
Fusion tag
  • 47
  • 16
  • 10
  • 9
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
Vector
  • 35
  • 34
  • 12
  • 10
  • 9
Insert
  • 44
  • 22
  • 21
  • 8
  • 6
Oligo-Type
  • 6
Resistance Gene
  • 44
  • 35
  • 20
  • 4
  • 2
Expression Type
  • 93
  • 50
  • 2
Selectable Marker
  • 29
  • 26
Promoter
  • 31
  • 31
  • 15
  • 13
  • 8
Format
  • 38
  • 27
  • 22
  • 22
Supplier: Log in to see

ORF Cloning-Vector holds the gene between an AflII and EcoRV cut site.

Type:
ORF
Application:
Cloning
Gene:
Apoptosis Antagonizing Transcription Factor (AATF)
Species:
Human
Synonyms:
AATF, aatf, BFR2, NAEGRDRAFT_56916, Aatf, aatf.S
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5719944
$70.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Mammalian Vector with ORF clone of Human apoptosis antagonizing transcription factor (AATF)

Type:
ORF
Application:
Protein Expression
Gene:
Apoptosis Antagonizing Transcription Factor (AATF)
NCBI Accession:
NM_012138,NP_036270
Species:
Human
Synonyms:
AATF, aatf, BFR2, NAEGRDRAFT_56916, Aatf, aatf.S
Insert length:
1683 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5334021
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see

Full length Danio rerio apoptosis antagonizing transcription factor cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Apoptosis Antagonizing Transcription Factor (AATF)
Gene ID:
559477 (Zebrafish (Danio rerio), AATF)
Synonyms:
AATF, aatf, BFR2, NAEGRDRAFT_56916, Aatf, aatf.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4065915
$99.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Xenopus tropicalis apoptosis antagonizing transcription factor cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Apoptosis Antagonizing Transcription Factor (AATF)
Gene ID:
549062 (Xenopus tropicalis, AATF)
Synonyms:
AATF, aatf, BFR2, NAEGRDRAFT_56916, Aatf, aatf.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS108
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4030245
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Mus musculus apoptosis antagonizing transcription factor cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Apoptosis Antagonizing Transcription Factor (AATF)
Gene ID:
56321 (Mouse (Murine), AATF)
Synonyms:
AATF, aatf, BFR2, NAEGRDRAFT_56916, Aatf, aatf.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3817027
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Rattus norvegicus apoptosis antagonizing transcription factor cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Apoptosis Antagonizing Transcription Factor (AATF)
Gene ID:
114512 (Rat (Rattus), AATF)
Synonyms:
AATF, aatf, BFR2, NAEGRDRAFT_56916, Aatf, aatf.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4047844
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Xenopus tropicalis apoptosis antagonizing transcription factor cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Apoptosis Antagonizing Transcription Factor (AATF)
Gene ID:
549062 (Xenopus tropicalis, AATF)
Synonyms:
AATF, aatf, BFR2, NAEGRDRAFT_56916, Aatf, aatf.S
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4022062
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Xenopus tropicalis apoptosis antagonizing transcription factor cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Apoptosis Antagonizing Transcription Factor (AATF)
Gene ID:
549062 (Xenopus tropicalis, AATF)
Synonyms:
AATF, aatf, BFR2, NAEGRDRAFT_56916, Aatf, aatf.S
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4022061
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Homo sapiens apoptosis antagonizing transcription factor cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Apoptosis Antagonizing Transcription Factor (AATF)
Gene ID:
26574 (Human, AATF)
Synonyms:
AATF, aatf, BFR2, NAEGRDRAFT_56916, Aatf, aatf.S
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4090285
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Xenopus laevis apoptosis antagonizing transcription factor cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Apoptosis Antagonizing Transcription Factor (AATF)
Gene ID:
100381006 (Xenopus laevis, AATF)
Synonyms:
AATF, aatf, BFR2, NAEGRDRAFT_56916, Aatf, aatf.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3874946
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Clone DNA of Rattus norvegicus apoptosis antagonizing transcription factor

Type:
cDNA
Application:
Cloning
Gene:
Apoptosis Antagonizing Transcription Factor (AATF)
NCBI Accession:
NM_053720
Species:
Rat (Rattus)
Synonyms:
AATF, aatf, BFR2, NAEGRDRAFT_56916, Aatf, aatf.S
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3545837
$125.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Danio rerio apoptosis antagonizing transcription factor cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Apoptosis Antagonizing Transcription Factor (AATF)
Gene ID:
559477 (Zebrafish (Danio rerio), AATF)
Synonyms:
AATF, aatf, BFR2, NAEGRDRAFT_56916, Aatf, aatf.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4065916
$139.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Xenopus tropicalis apoptosis antagonizing transcription factor cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Apoptosis Antagonizing Transcription Factor (AATF)
Gene ID:
549062 (Xenopus tropicalis, AATF)
Synonyms:
AATF, aatf, BFR2, NAEGRDRAFT_56916, Aatf, aatf.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS108
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4030246
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Mus musculus apoptosis antagonizing transcription factor cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Apoptosis Antagonizing Transcription Factor (AATF)
Gene ID:
56321 (Mouse (Murine), AATF)
Synonyms:
AATF, aatf, BFR2, NAEGRDRAFT_56916, Aatf, aatf.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3817028
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Rattus norvegicus apoptosis antagonizing transcription factor cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Apoptosis Antagonizing Transcription Factor (AATF)
Gene ID:
114512 (Rat (Rattus), AATF)
Synonyms:
AATF, aatf, BFR2, NAEGRDRAFT_56916, Aatf, aatf.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4047843
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Xenopus tropicalis apoptosis antagonizing transcription factor cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Apoptosis Antagonizing Transcription Factor (AATF)
Gene ID:
549062 (Xenopus tropicalis, AATF)
Synonyms:
AATF, aatf, BFR2, NAEGRDRAFT_56916, Aatf, aatf.S
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4022059
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Xenopus tropicalis apoptosis antagonizing transcription factor cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Apoptosis Antagonizing Transcription Factor (AATF)
Gene ID:
549062 (Xenopus tropicalis, AATF)
Synonyms:
AATF, aatf, BFR2, NAEGRDRAFT_56916, Aatf, aatf.S
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4022060
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens apoptosis antagonizing transcription factor cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Apoptosis Antagonizing Transcription Factor (AATF)
Gene ID:
26574 (Human, AATF)
Synonyms:
AATF, aatf, BFR2, NAEGRDRAFT_56916, Aatf, aatf.S
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4090286
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Xenopus laevis apoptosis antagonizing transcription factor cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Apoptosis Antagonizing Transcription Factor (AATF)
Gene ID:
100381006 (Xenopus laevis, AATF)
Synonyms:
AATF, aatf, BFR2, NAEGRDRAFT_56916, Aatf, aatf.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3874945
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Entry clone of human cDNA (ORF) without STOP codon in Gateway pDONR223 Vector.

Type:
ORF
Application:
Cloning
Gene:
Apoptosis Antagonizing Transcription Factor (AATF)
Gene ID:
26574 (Human, AATF)
Synonyms:
AATF, aatf, BFR2, NAEGRDRAFT_56916, Aatf, aatf.S
Insert length:
1683 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5313542
$204.60
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
  • <
  • 1

Synonyms and alternative names related to AATF

  • apoptosis antagonizing transcription factor (AATF)
  • apoptosis antagonizing transcription factor (aatf)
  • Apoptosis antagonizing transcription factor (BFR2)
  • apoptosis antagonizing transcription factor (NAEGRDRAFT_56916)
  • apoptosis antagonizing transcription factor (Aatf)
  • apoptosis antagonizing transcription factor S homeolog (aatf.S)
  • 4933415H02Rik
  • 5830465M17Rik
  • AATF
  • cb109
  • che-1
  • CHE-1
  • Che-1
  • che1
  • CHE1
  • ded
  • DED
  • Ded
  • sb:cb109
  • Trb
  • wu:fc13d05
  • zgc:162071

Gene-IDs for different species

GENE IDSPECIES
100057601 Equus caballus
454601 Pan troglodytes
549062 Xenopus (Silurana) tropicalis
559477 Danio rerio
717586 Macaca mulatta
4852007 Scheffersomyces stipitis CBS 6054
8852758 Naegleria gruberi strain NEG-M
100404639 Callithrix jacchus
100451788 Pongo abelii
100580798 Nomascus leucogenys
26574 Homo sapiens
480595 Canis lupus familiaris
417653 Gallus gallus
786013 Bos taurus
56321 Mus musculus
114512 Rattus norvegicus
100381006 Xenopus laevis
100513881 Sus scrofa
100732839 Cavia porcellus
100356226 Oryctolagus cuniculus
101109984 Ovis aries

Protein level used designations for AATF

  • apoptosis antagonizing transcription factor
  • protein AATF
  • Apoptosis antagonizing transcription factor
  • protein AATF-like
  • apoptosis-antagonizing transcription factor
  • rb-binding protein Che-1
  • traube protein
Other products related to AATF such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com