ABCC3 (ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 3, ABCC3)

Short Description: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The specific function of this protein has not yet been determined\; however, this protein may play a role in the transport of biliary and intestinal excretion of organic anions. Alternatively spliced variants which encode different protein isoforms have been described\; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008].
More information related to gene ABCC3.
Products related to ABCC3 Gene:
101 Products
Data Quality
  • 1
  • 96
  • 5
  • 44
  • 30
  • 23
  • 2
  • 2
  • 50
  • 26
  • 25
  • 16
Fusion tag
  • 38
  • 16
  • 10
  • 9
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 5
  • 33
  • 32
  • 12
  • 9
  • 9
  • 38
  • 21
  • 21
  • 8
  • 6
  • 5
Resistance Gene
  • 41
  • 35
  • 16
  • 4
  • 2
Expression Type
  • 89
  • 51
Selectable Marker
  • 27
  • 26
  • 6
  • 32
  • 31
  • 14
  • 10
  • 8
  • 39
  • 27
  • 20
  • 15
Supplier: Log in to see

Protein Expression, Cloning
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 3 (ABCC3)
Gene ID:
404609 (Zebrafish (Danio rerio), ABCC3)
ABCC3, Abcc3
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3877823
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 3 (ABCC3)
Gene ID:
76408 (Mouse (Murine), ABCC3)
ABCC3, Abcc3
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3997470
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 3 (ABCC3)
Gene ID:
8714 (Human, ABCC3)
ABCC3, Abcc3
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3996471
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression, Cloning
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 3 (ABCC3)
Gene ID:
100135090 (Xenopus tropicalis, ABCC3)
ABCC3, Abcc3
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3873369
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 3 (ABCC3)
Gene ID:
8714 (Human, ABCC3)
ABCC3, Abcc3
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3996472
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression, Cloning
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 3 (ABCC3)
Gene ID:
404609 (Zebrafish (Danio rerio), ABCC3)
ABCC3, Abcc3
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3847239
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression, Cloning
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 3 (ABCC3)
Gene ID:
100135090 (Xenopus tropicalis, ABCC3)
ABCC3, Abcc3
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3873370
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 3 (ABCC3)
Gene ID:
76408 (Mouse (Murine), ABCC3)
ABCC3, Abcc3
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3997469
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 3 (ABCC3)
Gene ID:
8714 (Human, ABCC3)
ABCC3, Abcc3
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3996473
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 3 (ABCC3)
Gene ID:
8714 (Human, ABCC3)
ABCC3, Abcc3
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3996474
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 3 (ABCC3)
Gene ID:
8714 (Human, ABCC3)
ABCC3, Abcc3
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3415600
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 3 (ABCC3)
NCBI Accession:
ABCC3, Abcc3
Insert length:
1719 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5478702
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see

RNA Interference
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 3
ABC31, EST90757, MLP2, MOAT-D, MRP3, cMOAT2, 1700019L09Rik, Mlp2, Mrp3
HPLC purified
Available with shipment
  • ABCC3 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
-20 °C
Catalog No. ABIN3345500
1 kit
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days
Supplier: Log in to see

Protein Expression
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 3 (ABCC3)
NCBI Accession:
ABCC3, Abcc3
Insert length:
4584 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5478701
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see

Genome Editing with Engineered Nucleases, Protein Expression
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 3 (ABCC3)
NCBI Accession:
Mouse (Murine)
ABCC3, Abcc3
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Abcc3
Viral Particles
-80 °C
Catalog No. ABIN5165922
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Supplier: Log in to see

Genome Editing with Engineered Nucleases, Protein Expression
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 3 (ABCC3)
NCBI Accession:
Rat (Rattus)
ABCC3, Abcc3
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Abcc3
Viral Particles
-80 °C
Catalog No. ABIN5165924
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Supplier: Log in to see

Genome Editing with Engineered Nucleases, Protein Expression
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 3 (ABCC3)
NCBI Accession:
ABCC3, Abcc3
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ABCC3
Viral Particles
-80 °C
Catalog No. ABIN5165920
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Supplier: Log in to see

RNA Interference
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 3
Mouse (Murine)
ABC31, EST90757, MLP2, MOAT-D, MRP3, cMOAT2, 1700019L09Rik, Mlp2, Mrp3
HPLC purified
Available with shipment
  • Abcc3 (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
-20 °C
Catalog No. ABIN3349813
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

RNA Interference
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 3
Gene ID:
140668 (Rat (Rattus), ABCC3)
ABC31, EST90757, MLP2, MOAT-D, MRP3, cMOAT2, 1700019L09Rik, Mlp2, Mrp3
Oligonucleotide synthesis is monitored base by base through trityl analysis to ensure appropriate coupling efficiency. The oligo is subsequently purified by affinity-solid phase extraction. The annealed RNA duplex is further analyzed by mass spectrometry to verify the exact composition of the duplex. Each lot is compared to the previous lot by mass spectrometry to ensure maximum lot-to-lot consistency.
This product is provided as two 5 nmol vials (10 nmol), three 5 nmol vials (15 nmol) or 2x three 5 nmol vials (30 nmol) of lyophilized siRNA oligo duplexes. Each vial contains slightly different sequences to ensure full knockout of the gene. Each vial contains slightly different sequences to ensure full knockout of the gene. The duplexes can be transfected individually or pooled together to achieve knockdown of the target gene, which is most commonly assessed by qPCR or western blot. The siRNA oligos are also chemically modified (2'-OMe) for increased stability and enhanced knockdown in vitro and in vivo.
-20 °C
Catalog No. ABIN5801722
Plus shipping costs $45.00
Delivery in 16 to 26 Business Days
Supplier: Log in to see

RNA Interference
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 3
Gene ID:
76408 (Mouse (Murine), ABCC3)
ABC31, EST90757, MLP2, MOAT-D, MRP3, cMOAT2, 1700019L09Rik, Mlp2, Mrp3
Oligonucleotide synthesis is monitored base by base through trityl analysis to ensure appropriate coupling efficiency. The oligo is subsequently purified by affinity-solid phase extraction. The annealed RNA duplex is further analyzed by mass spectrometry to verify the exact composition of the duplex. Each lot is compared to the previous lot by mass spectrometry to ensure maximum lot-to-lot consistency.
This product is provided as two 5 nmol vials (10 nmol), three 5 nmol vials (15 nmol) or 2x three 5 nmol vials (30 nmol) of lyophilized siRNA oligo duplexes. Each vial contains slightly different sequences to ensure full knockout of the gene. Each vial contains slightly different sequences to ensure full knockout of the gene. The duplexes can be transfected individually or pooled together to achieve knockdown of the target gene, which is most commonly assessed by qPCR or western blot. The siRNA oligos are also chemically modified (2'-OMe) for increased stability and enhanced knockdown in vitro and in vivo.
-20 °C
Catalog No. ABIN5801723
Plus shipping costs $45.00
Delivery in 16 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to ABCC3

  • ATP binding cassette subfamily C member 3 (ABCC3)
  • ATP-binding cassette, sub-family C (CFTR/MRP), member 3 (Abcc3)
  • ATP binding cassette subfamily C member 3 (Abcc3)
  • 1700019L09Rik
  • ABC31
  • cMOAT2
  • EST90757
  • MLP2
  • Mlp2
  • MOAT-D
  • MRP3
  • Mrp3

Gene-IDs for different species

8714 Homo sapiens
76408 Mus musculus
140668 Rattus norvegicus
100713825 Cavia porcellus
422099 Gallus gallus
533151 Bos taurus
491084 Canis lupus familiaris

Protein level used designations for ABCC3

  • ATP-binding cassette sub-family C member 3
  • canalicular multispecific organic anion transporter 2
  • canicular multispecific organic anion transporter
  • multi-specific organic anion transporter D
  • multidrug resistance associated protein
  • multidrug resistance-associated protein 3
  • ATP-binding cassette protein C3
  • ATP-binding cassette transporter
  • transporter
  • ATP-binding cassette, sub-family C (CFTR/MRP), member 3
  • MLP-2
  • MRP-like protein 2
  • multidrug resistance protein 3
  • organic anion transporter
Other products related to ABCC3 such as antibodies, ELISA kits and high-purity proteins are available on our partner website