ABCC4 (ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 4, ABCC4)

Short Description: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The specific function of this protein has not yet been determined\; however, this protein may play a role in cellular detoxification as a pump for its substrate, organic anions. Alternative splicing results in multiple splice variants encoding different isoforms. [provided by RefSeq, Jul 2008].
More information related to gene ABCC4.
Products related to ABCC4 Gene:
141 Products
  • 136
  • 5
  • 61
  • 58
  • 22
  • 80
  • 33
  • 23
  • 16
  • 1
Fusion tag
  • 42
  • 18
  • 17
  • 16
  • 8
Vector Backbone
  • 12
  • 9
  • 9
  • 6
  • 6
  • 53
  • 41
  • 20
  • 11
  • 9
  • 55
  • 46
  • 19
  • 8
  • 6
  • 4
  • 1
Resistance Gene
  • 70
  • 34
  • 26
  • 6
  • 2
Expression Type
  • 117
  • 60
  • 11
Selectable Marker
  • 41
  • 26
  • 11
  • 4
  • 50
  • 29
  • 21
  • 21
  • 8
  • 62
  • 45
  • 24
  • 10
Supplier: Log in to see

ORF Cloning-Vector holds the gene between an AflII and EcoRV cut site.

ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 4 (ABCC4)
ABCC4, LOC515333, LOC616707, LOC695407, abcc4, Abcc4
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5737649
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Full length Homo sapiens ATP-binding cassette, sub-family C (CFTR/MRP), member 4 cDNA clone.

ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 4 (ABCC4)
Gene ID:
10257 (Human, ABCC4)
ABCC4, LOC515333, LOC616707, LOC695407, abcc4, Abcc4
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4088778
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Mus musculus ATP-binding cassette, sub-family C (CFTR/MRP), member 4 cDNA clone.

ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 4 (ABCC4)
Gene ID:
239273 (Mouse (Murine), ABCC4)
ABCC4, LOC515333, LOC616707, LOC695407, abcc4, Abcc4
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3997961
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Mus musculus ATP-binding cassette, sub-family C (CFTR/MRP), member 4 cDNA clone.

ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 4 (ABCC4)
Gene ID:
239273 (Mouse (Murine), ABCC4)
ABCC4, LOC515333, LOC616707, LOC695407, abcc4, Abcc4
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3997960
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens ATP-binding cassette, sub-family C (CFTR/MRP), member 4.

ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 4 (ABCC4)
ABCC4, LOC515333, LOC616707, LOC695407, abcc4, Abcc4
Vector type:
TA-Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Catalog No. ABIN3545846
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Verified forward and reverse primers for analyzing the quantitative expression of gene

Quantitative real-time PCR
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 4
EST170205, MOAT-B, MOATB, MRP4, D630049P08Rik, Mrp4
-20 °C
Catalog No. ABIN3192470
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Mus musculus ATP-binding cassette, sub-family C (CFTR/MRP), member 4 cDNA clone.

ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 4 (ABCC4)
Gene ID:
239273 (Mouse (Murine), ABCC4)
ABCC4, LOC515333, LOC616707, LOC695407, abcc4, Abcc4
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3997962
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens ATP-binding cassette, sub-family C (CFTR/MRP), member 4 cDNA clone.

ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 4 (ABCC4)
Gene ID:
10257 (Human, ABCC4)
ABCC4, LOC515333, LOC616707, LOC695407, abcc4, Abcc4
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4088777
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Mus musculus ATP-binding cassette, sub-family C (CFTR/MRP), member 4 cDNA clone.

ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 4 (ABCC4)
Gene ID:
239273 (Mouse (Murine), ABCC4)
ABCC4, LOC515333, LOC616707, LOC695407, abcc4, Abcc4
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3997959
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Entry clone of human cDNA (ORF) without STOP codon in Gateway pDONR223 Vector.

ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 4 (ABCC4)
Gene ID:
10257 (Human, ABCC4)
ABCC4, LOC515333, LOC616707, LOC695407, abcc4, Abcc4
Insert length:
2580 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
2 μg of lyophilized gene in pDONR223 vector
-20 °C
Catalog No. ABIN5322836
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
Supplier: Log in to see

Bacterial expression of Human ABCC4 with His tag

ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 4 (ABCC4)
ABCC4, LOC515333, LOC616707, LOC695407, abcc4, Abcc4
Insert length:
2580 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4372117
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Mammalian expression of Human ABCC4 with HA tag

Protein Expression
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 4 (ABCC4)
ABCC4, LOC515333, LOC616707, LOC695407, abcc4, Abcc4
Insert length:
2580 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
HA tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4372548
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Mammalian expression of Human ABCC4 with DYKDDDDK Tag,HA tag

Protein Expression
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 4 (ABCC4)
ABCC4, LOC515333, LOC616707, LOC695407, abcc4, Abcc4
Insert length:
2580 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4497997
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Mammalian expression of Human ABCC4 with His tag

Protein Expression
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 4 (ABCC4)
ABCC4, LOC515333, LOC616707, LOC695407, abcc4, Abcc4
Insert length:
2580 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
His tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4432745
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Human ABCC4 with His-GST

ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 4 (ABCC4)
ABCC4, LOC515333, LOC616707, LOC695407, abcc4, Abcc4
Insert length:
2580 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4825921
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Human ABCC4 with His tag

ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 4 (ABCC4)
ABCC4, LOC515333, LOC616707, LOC695407, abcc4, Abcc4
Insert length:
2580 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4758025
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Human ABCC4 with His-MBP

ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 4 (ABCC4)
ABCC4, LOC515333, LOC616707, LOC695407, abcc4, Abcc4
Insert length:
2580 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4696792
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Mammalian expression of Human ABCC4 with DYKDDDDK Tag,His tag

Protein Expression
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 4 (ABCC4)
ABCC4, LOC515333, LOC616707, LOC695407, abcc4, Abcc4
Insert length:
2580 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag,His tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4559206
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Mammalian Vector with ORF clone of Human ATP-binding cassette, sub-family C (CFTR/MRP), member 4 (ABCC4) transcript variant 2

Protein Expression
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 4 (ABCC4)
NCBI Accession:
ABCC4, LOC515333, LOC616707, LOC695407, abcc4, Abcc4
Insert length:
2580 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5391431
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see

Individual gRNA against ABCC4 in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Genome Editing with Engineered Nucleases, Protein Expression
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 4 (ABCC4)
NCBI Accession:
ABCC4, LOC515333, LOC616707, LOC695407, abcc4, Abcc4
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ABCC4
Viral Particles
-80 °C
Catalog No. ABIN5113324
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
  • <
  • 1

Synonyms and alternative names related to ABCC4

  • ATP binding cassette subfamily C member 4 (ABCC4)
  • multidrug resistance-associated protein 4 (LOC515333)
  • multidrug resistance-associated protein 4 (LOC616707)
  • multidrug resistance-associated protein 4 (LOC695407)
  • ATP binding cassette subfamily C member 4 (abcc4)
  • ATP-binding cassette, sub-family C (CFTR/MRP), member 4 (Abcc4)
  • ATP binding cassette subfamily C member 4 (Abcc4)
  • D630049P08Rik
  • EST170205
  • MOAT-B
  • MRP4
  • Mrp4

Gene-IDs for different species

485523 Canis lupus familiaris
515333 Bos taurus
616707 Bos taurus
695407 Macaca mulatta
100027089 Monodelphis domestica
100050431 Equus caballus
100081616 Ornithorhynchus anatinus
100391624 Callithrix jacchus
100466405 Ailuropoda melanoleuca
100491006 Xenopus (Silurana) tropicalis
10257 Homo sapiens
239273 Mus musculus
170924 Rattus norvegicus

Protein level used designations for ABCC4

  • multidrug resistance-associated protein 4
  • ATP-binding cassette, sub-family C (CFTR/MRP), member 4
  • ATP-binding cassette protein C4-like
  • multidrug resistance-associated protein 4-like
  • ATP-binding cassette sub-family C member 4
  • MRP/cMOAT-related ABC transporter
  • bA464I2.1 (ATP-binding cassette, sub-family C (CFTR/MRP), member 4)
  • canalicular multispecific organic anion transporter (ABC superfamily)
  • multi-specific organic anion transporter B
  • multispecific organic anion transporter B
  • ABC-tranporter
  • ATP-binding cassette protein C4
Other products related to ABCC4 such as antibodies, ELISA kits and high-purity proteins are available on our partner website