ABCC5 (ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 5, ABCC5)

Short Description: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This protein functions in the cellular export of its substrate, cyclic nucleotides. This export contributes to the degradation of phosphodiesterases and possibly an elimination pathway for cyclic nucleotides. Studies show that this protein provides resistance to thiopurine anticancer drugs, 6-mercatopurine and thioguanine, and the anti-HIV drug 9-(2-phosphonylmethoxyethyl)adenine. This protein may be involved in resistance to thiopurines in acute lymphoblastic leukemia and antiretroviral nucleoside analogs in HIV-infected patients. Alternative splicing of this gene has been detected\; however, the complete sequence and translation initiation site is unclear. [provided by RefSeq, Jul 2008].
More information related to gene ABCC5.
Products related to ABCC5 Gene:
115 Products
Type
  • 109
  • 6
Species
  • 44
  • 41
  • 24
  • 2
  • 2
Application
  • 60
  • 30
  • 27
  • 16
Fusion tag
  • 40
  • 18
  • 12
  • 12
  • 8
Vector Backbone
  • 7
  • 7
  • 6
  • 6
  • 6
Vector
  • 39
  • 37
  • 16
  • 9
  • 8
Insert
  • 47
  • 25
  • 21
  • 8
  • 6
Oligo-Type
  • 6
Resistance Gene
  • 46
  • 39
  • 20
  • 4
  • 2
Expression Type
  • 105
  • 55
Selectable Marker
  • 32
  • 26
  • 2
Promoter
  • 40
  • 31
  • 18
  • 13
  • 8
Format
  • 43
  • 36
  • 22
  • 14

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 5 (ABCC5)
Gene ID:
398887 (Xenopus laevis, ABCC5)
Synonyms:
ABCC5, Abcc5, abcc5.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3846213
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 5 (ABCC5)
Gene ID:
100125060 (Xenopus tropicalis, ABCC5)
Synonyms:
ABCC5, Abcc5, abcc5.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3872672
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 5 (ABCC5)
Gene ID:
511769 (Cow (Bovine), ABCC5)
Synonyms:
ABCC5, Abcc5, abcc5.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4062377
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 5 (ABCC5)
Gene ID:
10057 (Human, ABCC5)
Synonyms:
ABCC5, Abcc5, abcc5.L
Vector type:
Cloning Vector
Vector backbone:
pCR-XL-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3996574
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 5 (ABCC5)
Gene ID:
398887 (Xenopus laevis, ABCC5)
Synonyms:
ABCC5, Abcc5, abcc5.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3846214
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 5 (ABCC5)
Gene ID:
100125060 (Xenopus tropicalis, ABCC5)
Synonyms:
ABCC5, Abcc5, abcc5.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3872673
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 5 (ABCC5)
Gene ID:
511769 (Cow (Bovine), ABCC5)
Synonyms:
ABCC5, Abcc5, abcc5.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4062378
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 5 (ABCC5)
Gene ID:
10057 (Human, ABCC5)
Synonyms:
ABCC5, Abcc5, abcc5.L
Vector type:
Cloning Vector
Vector backbone:
pCR-XL-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3996573
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 5 (ABCC5)
NCBI Accession:
NM_001023587,NP_001018881
Species:
Human
Synonyms:
ABCC5, Abcc5, abcc5.L
Insert length:
600 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948183

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3380845
$410.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 5 (ABCC5)
NCBI Accession:
NM_176839,NP_789809
Species:
Mouse (Murine)
Synonyms:
ABCC5, Abcc5, abcc5.L
Insert length:
627 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3322825
$410.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 5 (ABCC5)
NCBI Accession:
NM_001023587,NP_001018881
Species:
Human
Synonyms:
ABCC5, Abcc5, abcc5.L
Insert length:
627 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5391441
$410.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Application:
RNA Interference
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 5
Species:
Mouse (Murine)
Synonyms:
ABC33, EST277145, MOAT-C, MOATC, MRP5, SMRP, pABC11, 2900011L11Rik, AI132311, Abcc5a, Abcc5b, Mrp5, abc33, abcc5, moat-c, moatc, mrp5, pabc11, smrp
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Abcc5 (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3349694
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 5
Species:
Human
Synonyms:
ABC33, EST277145, MOAT-C, MOATC, MRP5, SMRP, pABC11, 2900011L11Rik, AI132311, Abcc5a, Abcc5b, Mrp5, abc33, abcc5, moat-c, moatc, mrp5, pabc11, smrp
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • ABCC5 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3346529
$420.00
1 kit
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Application:
RNA Interference
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 5
Species:
Rat (Rattus)
Synonyms:
ABC33, EST277145, MOAT-C, MOATC, MRP5, SMRP, pABC11, 2900011L11Rik, AI132311, Abcc5a, Abcc5b, Mrp5, abc33, abcc5, moat-c, moatc, mrp5, pabc11, smrp
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Abcc5 (Rat) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3352326
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 5 (ABCC5)
NCBI Accession:
NM_005688
Species:
Human
Synonyms:
ABCC5, Abcc5, abcc5.L
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ABCC5
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5113330
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 5 (ABCC5)
NCBI Accession:
NM_013790
Species:
Mouse (Murine)
Synonyms:
ABCC5, Abcc5, abcc5.L
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Abcc5
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5113332
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 5 (ABCC5)
NCBI Accession:
NM_053924
Species:
Rat (Rattus)
Synonyms:
ABCC5, Abcc5, abcc5.L
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Abcc5
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5113334
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
ORF
Application:
Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 5 (ABCC5)
Species:
Human
Synonyms:
ABCC5, Abcc5, abcc5.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC-GFP
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
GFP tag
Expression:
Stable, Transient

Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5391439
$460.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 5 (ABCC5)
Gene ID:
10057 (Human, ABCC5)
Synonyms:
ABCC5, Abcc5, abcc5.L
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter, U6 Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable

Viral particles:
ABIN5047204

Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN5028259
$503.00
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
ATP-Binding Cassette, Sub-Family C (CFTR/MRP), Member 5
Gene ID:
10057 (Human, ABCC5)
Synonyms:
ABC33, EST277145, MOAT-C, MOATC, MRP5, SMRP, pABC11, 2900011L11Rik, AI132311, Abcc5a, Abcc5b, Mrp5, abc33, abcc5, moat-c, moatc, mrp5, pabc11, smrp
Purification:
Oligonucleotide synthesis is monitored base by base through trityl analysis to ensure appropriate coupling efficiency. The oligo is subsequently purified by affinity-solid phase extraction. The annealed RNA duplex is further analyzed by mass spectrometry to verify the exact composition of the duplex. Each lot is compared to the previous lot by mass spectrometry to ensure maximum lot-to-lot consistency.
Components:
This product is provided as two 5 nmol vials (10 nmol), three 5 nmol vials (15 nmol) or 2x three 5 nmol vials (30 nmol) of lyophilized siRNA oligo duplexes. Each vial contains slightly different sequences to ensure full knockout of the gene. Each vial contains slightly different sequences to ensure full knockout of the gene. The duplexes can be transfected individually or pooled together to achieve knockdown of the target gene, which is most commonly assessed by qPCR or western blot. The siRNA oligos are also chemically modified (2'-OMe) for increased stability and enhanced knockdown in vitro and in vivo.
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5789217
$516.85
Plus shipping costs $45.00
Delivery in 16 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to ABCC5

  • ATP binding cassette subfamily C member 5 (ABCC5)
  • ATP-binding cassette, sub-family C (CFTR/MRP), member 5 (Abcc5)
  • ATP binding cassette subfamily C member 5 (Abcc5)
  • ATP binding cassette subfamily C member 5 L homeolog (abcc5.L)
  • 2900011L11Rik
  • ABC33
  • abc33
  • abcc5
  • Abcc5a
  • Abcc5b
  • AI132311
  • EST277145
  • MOAT-C
  • moat-c
  • MOATC
  • moatc
  • MRP5
  • Mrp5
  • mrp5
  • pABC11
  • pabc11
  • SMRP
  • smrp

Gene-IDs for different species

GENE IDSPECIES
10057 Homo sapiens
27416 Mus musculus
116721 Rattus norvegicus
100723026 Cavia porcellus
398887 Xenopus laevis
100351084 Oryctolagus cuniculus
100513626 Sus scrofa
100066941 Equus caballus
511769 Bos taurus
478648 Canis lupus familiaris

Protein level used designations for ABCC5

  • ATP-binding cassette sub-family C member 5
  • canalicular multispecific organic anion transporter C
  • multi-specific organic anion transporter C
  • multidrug resistance-associated protein 5
  • ATP-binding cassette, sub-family C (CFTR/MRP), member 5a
  • ATP-binding cassette, sub-family C (CFTR/MRP), member 5b
  • ATP-binding cassette, sub-family C, member 5
  • MOAT-C
  • SMRP
  • ATP-binding cassette sub-family C (CFTR/MRP) member 5a
  • ATP-binding cassette, sub-family C (CFTR/MRP), member 5
  • ATP binding cassette subfamily C member 5 L homeolog
Other products related to ABCC5 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com