ABCD1 (ATP-Binding Cassette, Sub-Family D (Ald), Member 1, ABCD1)

Short Description: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ALD subfamily, which is involved in peroxisomal import of fatty acids and/or fatty acyl-CoAs in the organelle. All known peroxisomal ABC transporters are half transporters which require a partner half transporter molecule to form a functional homodimeric or heterodimeric transporter. This peroxisomal membrane protein is likely involved in the peroxisomal transport or catabolism of very long chain fatty acids. Defects in this gene have been identified as the underlying cause of adrenoleukodystrophy, an X-chromosome recessively inherited demyelinating disorder of the nervous system. [provided by RefSeq, Jul 2008].
More information related to gene ABCD1.
Products related to ABCD1 Gene:
Type
  • 103
  • 3
Species
  • 40
  • 35
  • 28
  • 2
  • 1
Application
  • 63
  • 23
  • 21
  • 16
Fusion tag
  • 35
  • 13
  • 11
  • 10
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
Vector
  • 39
  • 35
  • 12
  • 9
  • 5
Insert
  • 35
  • 34
  • 18
  • 8
  • 6
Oligo-Type
  • 3
Resistance Gene
  • 45
  • 36
  • 19
  • 3
  • 2
Expression Type
  • 85
  • 46
  • 13
Selectable Marker
  • 26
  • 22
  • 13
Promoter
  • 28
  • 28
  • 23
  • 13
  • 8
Format
  • 44
  • 27
  • 22
  • 13
106 Products

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
ATP-Binding Cassette, Sub-Family D (Ald), Member 1 (ABCD1)
Gene ID:
566367 (Zebrafish (Danio rerio), ABCD1)
Synonyms:
ABCD1, Abcd1, abcd1, CpipJ_CPIJ013253, VDBG_05717, abcd1.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4066264
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
ATP-Binding Cassette, Sub-Family D (Ald), Member 1 (ABCD1)
Gene ID:
566367 (Zebrafish (Danio rerio), ABCD1)
Synonyms:
ABCD1, Abcd1, abcd1, CpipJ_CPIJ013253, VDBG_05717, abcd1.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4066265
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
ATP-Binding Cassette, Sub-Family D (Ald), Member 1 (ABCD1)
NCBI Accession:
NM_001108821
Species:
Rat
Synonyms:
ABCD1, Abcd1, abcd1, CpipJ_CPIJ013253, VDBG_05717, abcd1.L
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3545847
$158.97
1 vial
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
ATP-Binding Cassette, Sub-Family D (Ald), Member 1 (ABCD1)
Gene ID:
215 (Human, ABCD1)
Synonyms:
ABCD1, Abcd1, abcd1, CpipJ_CPIJ013253, VDBG_05717, abcd1.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3803155
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
ATP-Binding Cassette, Sub-Family D (Ald), Member 1 (ABCD1)
Gene ID:
11666 (Mouse, ABCD1)
Synonyms:
ABCD1, Abcd1, abcd1, CpipJ_CPIJ013253, VDBG_05717, abcd1.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3807569
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
ATP-Binding Cassette, Sub-Family D (Ald), Member 1 (ABCD1)
Gene ID:
515178 (Cow, ABCD1)
Synonyms:
ABCD1, Abcd1, abcd1, CpipJ_CPIJ013253, VDBG_05717, abcd1.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4062977
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
ATP-Binding Cassette, Sub-Family D (Ald), Member 1 (ABCD1)
Gene ID:
215 (Human, ABCD1)
Synonyms:
ABCD1, Abcd1, abcd1, CpipJ_CPIJ013253, VDBG_05717, abcd1.L
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4083088
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family D (Ald), Member 1 (ABCD1)
Gene ID:
215 (Human, ABCD1)
Synonyms:
ABCD1, Abcd1, abcd1, CpipJ_CPIJ013253, VDBG_05717, abcd1.L
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR221
Resistance Gene:
Kanamycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3418839
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family D (Ald), Member 1 (ABCD1)
Gene ID:
215 (Human, ABCD1)
Synonyms:
ABCD1, Abcd1, abcd1, CpipJ_CPIJ013253, VDBG_05717, abcd1.L
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR221
Resistance Gene:
Kanamycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3422014
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family D (Ald), Member 1 (ABCD1)
NCBI Accession:
NM_007435
Species:
Mouse
Synonyms:
ABCD1, Abcd1, abcd1, CpipJ_CPIJ013253, VDBG_05717, abcd1.L
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Abcd1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5104381
$420.00
300 μL
Plus shipping costs $45.00 and $24.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family D (Ald), Member 1 (ABCD1)
NCBI Accession:
NM_001108821
Species:
Rat
Synonyms:
ABCD1, Abcd1, abcd1, CpipJ_CPIJ013253, VDBG_05717, abcd1.L
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Abcd1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5104383
$420.00
300 μL
Plus shipping costs $45.00 and $24.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family D (Ald), Member 1 (ABCD1)
NCBI Accession:
NM_000033
Species:
Human
Synonyms:
ABCD1, Abcd1, abcd1, CpipJ_CPIJ013253, VDBG_05717, abcd1.L
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ABCD1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5104375
$420.00
300 μL
Plus shipping costs $45.00 and $24.00 dry ice
Available

Type:
ORF
Application:
Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family D (Ald), Member 1 (ABCD1)
NCBI Accession:
NM_000033,NP_000024
Species:
Human
Synonyms:
ABCD1, Abcd1, abcd1, CpipJ_CPIJ013253, VDBG_05717, abcd1.L
Insert length:
2238 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5391469
$433.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Application:
RNA Interference
Gene:
ATP-Binding Cassette, Sub-Family D (Ald), Member 1
Species:
Mouse
Synonyms:
ABC42, ALD, ALDP, AMN, RGD1562128, zgc:172102, ABCD1, Ald, Aldgh
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Abcd1 (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3262856
$440.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
ATP-Binding Cassette, Sub-Family D (Ald), Member 1
Species:
Human
Synonyms:
ABC42, ALD, ALDP, AMN, RGD1562128, zgc:172102, ABCD1, Ald, Aldgh
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • ABCD1 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3339945
$440.00
1 kit
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Application:
RNA Interference
Gene:
ATP-Binding Cassette, Sub-Family D (Ald), Member 1
Species:
Rat
Synonyms:
ABC42, ALD, ALDP, AMN, RGD1562128, zgc:172102, ABCD1, Ald, Aldgh
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Abcd1 (Rat) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3351656
$440.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family D (Ald), Member 1 (ABCD1)
Species:
Human
Synonyms:
ABCD1, Abcd1, abcd1, CpipJ_CPIJ013253, VDBG_05717, abcd1.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC-GFP
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
GFP tag
Expression:
Stable, Transient

Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5391468
$470.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
ATP-Binding Cassette, Sub-Family D (Ald), Member 1 (ABCD1)
Gene ID:
215 (Human, ABCD1)
Synonyms:
ABCD1, Abcd1, abcd1, CpipJ_CPIJ013253, VDBG_05717, abcd1.L
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter, U6 Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable

Viral particles:
ABIN5051171

Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN5032226
$503.00
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
ORF
Application:
Cloning
Gene:
ATP-Binding Cassette, Sub-Family D (Ald), Member 1 (ABCD1)
NCBI Accession:
NM_000033
Species:
Human
Synonyms:
ABCD1, Abcd1, abcd1, CpipJ_CPIJ013253, VDBG_05717, abcd1.L
Insert length:
2238 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5732880
$511.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family D (Ald), Member 1 (ABCD1)
NCBI Accession:
NM_000033
Species:
Human
Synonyms:
ABCD1, Abcd1, abcd1, CpipJ_CPIJ013253, VDBG_05717, abcd1.L
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ABCD1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5219634
$520.00
300 μL
Plus shipping costs $45.00 and $24.00 dry ice
Available
  • <
  • 1

Synonyms and alternative names related to ABCD1

  • ATP binding cassette subfamily D member 1 (ABCD1)
  • ATP binding cassette subfamily D member 1 (Abcd1)
  • ATP-binding cassette, sub-family D (ALD), member 1 (abcd1)
  • ATP-binding cassette sub-family D member 1 (CpipJ_CPIJ013253)
  • ATP-binding cassette sub-family D member 1 (VDBG_05717)
  • ATP-binding cassette, sub-family D (ALD), member 1 (Abcd1)
  • ATP binding cassette subfamily D member 1 L homeolog (abcd1.L)
  • ATP binding cassette subfamily D member 1 (abcd1)
  • ABC42
  • ABCD1
  • ALD
  • Ald
  • Aldgh
  • ALDP
  • AMN
  • RGD1562128
  • zgc:172102

Gene-IDs for different species

GENE IDSPECIES
215 Homo sapiens
363516 Rattus norvegicus
566367 Danio rerio
612520 Canis lupus familiaris
515178 Bos taurus
696794 Macaca mulatta
6046470 Culex quinquefasciatus
9531595 Verticillium alfalfae VaMs.102
100328741 Oryctolagus cuniculus
11666 Mus musculus
495468 Xenopus laevis
100493545 Xenopus (Silurana) tropicalis
100519529 Sus scrofa
100027916 Monodelphis domestica
100586126 Nomascus leucogenys
101122673 Ovis aries musimon

Protein level used designations for ABCD1

  • ATP-binding cassette sub-family D member 1
  • adrenoleukodystrophy protein
  • ATP-binding cassette, sub-family D (ALD), member 1
  • ATP-binding cassette, sub-family D, member 1
  • X-linked adrenoleukodystrophy (ALD) gene homolog
  • ATP-binding cassette sub-family D member 1-like
Other products related to ABCD1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com