ABCE1 (ATP-Binding Cassette, Sub-Family E (OABP), Member 1, ABCE1)

Short Description: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the OABP subfamily. Alternatively referred to as the RNase L inhibitor, this protein functions to block the activity of ribonuclease L. Activation of ribonuclease L leads to inhibition of protein synthesis in the 2-5A/RNase L system, the central pathway for viral interferon action. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008].
More information related to gene ABCE1.
Products related to ABCE1 Gene:
151 Products
  • 146
  • 5
  • 60
  • 44
  • 39
  • 2
  • 2
  • 4
  • 1
  • 67
  • 43
  • 20
  • 8
  • 6
  • 77
  • 40
  • 12
  • 9
  • 3
Vector Backbone
  • 8
  • 8
  • 6
  • 6
  • 6
Fusion tag
  • 47
  • 18
  • 15
  • 13
  • 9
Resistance Gene
  • 70
  • 49
  • 22
  • 5
  • 2
Selectable Marker
  • 39
  • 26
  • 26
  • 1
  • 56
  • 36
  • 30
  • 13
  • 8
Expression Type
  • 102
  • 51
  • 39
  • 103
  • 31
  • 24
  • 16
  • 1
  • 82
  • 27
  • 24
  • 18
Supplier: Log in to see

ORF Cloning-Vector holds the gene between an AflII and EcoRV cut site.

ATP-Binding Cassette, Sub-Family E (OABP), Member 1 (ABCE1)
ABCE1, abcE1, LOC100184673, LOC100213121, abce1, TP04_0855, PVX_115370, TERMP_RS03360, Abce1, abce1.S
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5737668
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens ATP-binding cassette, sub-family E (OABP), member 1.

ATP-Binding Cassette, Sub-Family E (OABP), Member 1 (ABCE1)
ABCE1, abcE1, LOC100184673, LOC100213121, abce1, TP04_0855, PVX_115370, TERMP_RS03360, Abce1, abce1.S
Vector type:
TA-Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Catalog No. ABIN3610595
1 vial
Plus shipping costs €45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Rattus norvegicus ATP-binding cassette, subfamily E (OABP), member 1.

ATP-Binding Cassette, Sub-Family E (OABP), Member 1 (ABCE1)
NCBI Accession:
Rat (Rattus)
ABCE1, abcE1, LOC100184673, LOC100213121, abce1, TP04_0855, PVX_115370, TERMP_RS03360, Abce1, abce1.S
Vector type:
TA-Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Catalog No. ABIN3610597
1 vial
Plus shipping costs €45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Mus musculus ATP-binding cassette, sub-family E (OABP), member 1.

ATP-Binding Cassette, Sub-Family E (OABP), Member 1 (ABCE1)
NCBI Accession:
Mouse (Murine)
ABCE1, abcE1, LOC100184673, LOC100213121, abce1, TP04_0855, PVX_115370, TERMP_RS03360, Abce1, abce1.S
Vector type:
TA-Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Catalog No. ABIN3610596
1 vial
Plus shipping costs €45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Verified forward and reverse primers for analyzing the quantitative expression of gene

Quantitative real-time PCR
ATP-Binding Cassette, Sub-Family E (OABP), Member 1
ABCE1, DDBDRAFT_0188931, DDBDRAFT_0191227, DDB_0188931, DDB_0191227, abce1, MGC69546, DKFZp469K1416, ABC38, OABP, RLI, RNASEL1, RNASELI, RNS4I, C79080, Oabp, RNS41, Rnaseli, wu:fb34c09, wu:fe47b01, wu:fi09g07, zgc:111906, zgc:56045, Rns4i
-20 °C
Catalog No. ABIN3192459
1 vial
Plus shipping costs €45.00
Delivery in 15 to 19 Business Days
Supplier: Log in to see

Full length Mus musculus ATP-binding cassette, sub-family E (OABP), member 1 cDNA clone.

Protein Expression, Cloning
ATP-Binding Cassette, Sub-Family E (OABP), Member 1 (ABCE1)
Gene ID:
24015 (Mouse (Murine), ABCE1)
ABCE1, abcE1, LOC100184673, LOC100213121, abce1, TP04_0855, PVX_115370, TERMP_RS03360, Abce1, abce1.S
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3811914
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Homo sapiens ATP-binding cassette, sub-family E (OABP), member 1 cDNA clone.

Protein Expression, Cloning
ATP-Binding Cassette, Sub-Family E (OABP), Member 1 (ABCE1)
Gene ID:
6059 (Human, ABCE1)
ABCE1, abcE1, LOC100184673, LOC100213121, abce1, TP04_0855, PVX_115370, TERMP_RS03360, Abce1, abce1.S
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3805276
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Xenopus laevis ATP-binding cassette, sub-family E (OABP), member 1 cDNA clone.

Protein Expression, Cloning
ATP-Binding Cassette, Sub-Family E (OABP), Member 1 (ABCE1)
Gene ID:
380454 (Xenopus laevis, ABCE1)
ABCE1, abcE1, LOC100184673, LOC100213121, abce1, TP04_0855, PVX_115370, TERMP_RS03360, Abce1, abce1.S
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3844286
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Xenopus tropicalis ATP-binding cassette, sub-family E (OABP), member 1 cDNA clone.

Protein Expression, Cloning
ATP-Binding Cassette, Sub-Family E (OABP), Member 1 (ABCE1)
Gene ID:
448085 (Xenopus tropicalis, ABCE1)
ABCE1, abcE1, LOC100184673, LOC100213121, abce1, TP04_0855, PVX_115370, TERMP_RS03360, Abce1, abce1.S
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3884944
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Bos taurus ATP-binding cassette, sub-family E (OABP), member 1 cDNA clone.

Protein Expression, Cloning
ATP-Binding Cassette, Sub-Family E (OABP), Member 1 (ABCE1)
Gene ID:
514991 (Cow (Bovine), ABCE1)
ABCE1, abcE1, LOC100184673, LOC100213121, abce1, TP04_0855, PVX_115370, TERMP_RS03360, Abce1, abce1.S
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4062951
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Mus musculus ATP-binding cassette, sub-family E (OABP), member 1 cDNA clone.

Protein Expression, Cloning
ATP-Binding Cassette, Sub-Family E (OABP), Member 1 (ABCE1)
Gene ID:
24015 (Mouse (Murine), ABCE1)
ABCE1, abcE1, LOC100184673, LOC100213121, abce1, TP04_0855, PVX_115370, TERMP_RS03360, Abce1, abce1.S
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3811916
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens ATP-binding cassette, sub-family E (OABP), member 1 cDNA clone.

Protein Expression, Cloning
ATP-Binding Cassette, Sub-Family E (OABP), Member 1 (ABCE1)
Gene ID:
6059 (Human, ABCE1)
ABCE1, abcE1, LOC100184673, LOC100213121, abce1, TP04_0855, PVX_115370, TERMP_RS03360, Abce1, abce1.S
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3805278
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Xenopus laevis ATP-binding cassette, sub-family E (OABP), member 1 cDNA clone.

Protein Expression, Cloning
ATP-Binding Cassette, Sub-Family E (OABP), Member 1 (ABCE1)
Gene ID:
380454 (Xenopus laevis, ABCE1)
ABCE1, abcE1, LOC100184673, LOC100213121, abce1, TP04_0855, PVX_115370, TERMP_RS03360, Abce1, abce1.S
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3844287
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Xenopus tropicalis ATP-binding cassette, sub-family E (OABP), member 1 cDNA clone.

Protein Expression, Cloning
ATP-Binding Cassette, Sub-Family E (OABP), Member 1 (ABCE1)
Gene ID:
448085 (Xenopus tropicalis, ABCE1)
ABCE1, abcE1, LOC100184673, LOC100213121, abce1, TP04_0855, PVX_115370, TERMP_RS03360, Abce1, abce1.S
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3884945
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Bos taurus ATP-binding cassette, sub-family E (OABP), member 1 cDNA clone.

Protein Expression, Cloning
ATP-Binding Cassette, Sub-Family E (OABP), Member 1 (ABCE1)
Gene ID:
514991 (Cow (Bovine), ABCE1)
ABCE1, abcE1, LOC100184673, LOC100213121, abce1, TP04_0855, PVX_115370, TERMP_RS03360, Abce1, abce1.S
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4062952
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human ABCE1 is ideal for over-expression of native protein for functional studies.

Protein Expression
ATP-Binding Cassette, Sub-Family E (OABP), Member 1 (ABCE1)
NCBI Accession:
ABCE1, abcE1, LOC100184673, LOC100213121, abce1, TP04_0855, PVX_115370, TERMP_RS03360, Abce1, abce1.S
Insert length:
2910 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
Catalog No. ABIN3381970
10 μg
Plus shipping costs €45.00
Delivery in 8 to 11 Business Days
Supplier: Log in to see

Entry clone of human cDNA (ORF) without STOP codon in Gateway pDONR223 Vector.

ATP-Binding Cassette, Sub-Family E (OABP), Member 1 (ABCE1)
Gene ID:
6059 (Human, ABCE1)
ABCE1, abcE1, LOC100184673, LOC100213121, abce1, TP04_0855, PVX_115370, TERMP_RS03360, Abce1, abce1.S
Insert length:
1800 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
2 μg of lyophilized gene in pDONR223 vector
-20 °C
Catalog No. ABIN5323073
2 μg
Plus shipping costs €45.00
Delivery in 15 to 17 Business Days
Supplier: Log in to see

Bacterial expression of Human ABCE1 with His-MBP

ATP-Binding Cassette, Sub-Family E (OABP), Member 1 (ABCE1)
ABCE1, abcE1, LOC100184673, LOC100213121, abce1, TP04_0855, PVX_115370, TERMP_RS03360, Abce1, abce1.S
Insert length:
1800 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4696801
500 ng
Plus shipping costs €45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Human ABCE1 with His-GST

ATP-Binding Cassette, Sub-Family E (OABP), Member 1 (ABCE1)
ABCE1, abcE1, LOC100184673, LOC100213121, abce1, TP04_0855, PVX_115370, TERMP_RS03360, Abce1, abce1.S
Insert length:
1800 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4825930
500 ng
Plus shipping costs €45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Human ABCE1 with His tag

ATP-Binding Cassette, Sub-Family E (OABP), Member 1 (ABCE1)
ABCE1, abcE1, LOC100184673, LOC100213121, abce1, TP04_0855, PVX_115370, TERMP_RS03360, Abce1, abce1.S
Insert length:
1800 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4758029
500 ng
Plus shipping costs €45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to ABCE1

  • ATP binding cassette subfamily E member 1 (ABCE1)
  • 4Fe-4S ferredoxin, iron-sulfur binding domain-containing protein (abcE1)
  • ATP-binding cassette sub-family E member 1 (LOC100184673)
  • ATP-binding cassette sub-family E member 1 (LOC100213121)
  • ATP binding cassette subfamily E member 1 (abce1)
  • RNAse L inhibitor (TP04_0855)
  • RNase L inhibitor (PVX_115370)
  • ribosome biogenesis/translation initiation ATPase RLI (TERMP_RS03360)
  • ATP-binding cassette, sub-family E (OABP), member 1 (Abce1)
  • ATP-binding cassette, sub-family E (OABP), member 1 (abce1)
  • ATP binding cassette subfamily E member 1 S homeolog (abce1.S)
  • ATP binding cassette subfamily E member 1 (Abce1)
  • ABC38
  • ABCE1
  • abce1
  • C79080
  • DDBDRAFT_0188931
  • DDBDRAFT_0191227
  • DDB_0188931
  • DDB_0191227
  • DKFZp469K1416
  • MGC69546
  • Oabp
  • OABP
  • RLI
  • Rnaseli
  • RNS4I
  • Rns4i
  • RNS41
  • wu:fb34c09
  • wu:fe47b01
  • wu:fi09g07
  • zgc:56045
  • zgc:111906

Gene-IDs for different species

100062815 Equus caballus
461523 Pan troglodytes
701945 Macaca mulatta
8627699 Dictyostelium discoideum AX4
100184673 Ciona intestinalis
100213121 Hydra magnipapillata
100342820 Oryctolagus cuniculus
100403878 Callithrix jacchus
448085 Xenopus (Silurana) tropicalis
100173523 Pongo abelii
100568180 Anolis carolinensis
100604050 Nomascus leucogenys
3500766 Theileria parva strain Muguga
5475763 Plasmodium vivax Sal-1
10040993 Thermococcus barophilus MP
6059 Homo sapiens
24015 Mus musculus
475454 Canis lupus familiaris
514991 Bos taurus
406324 Danio rerio
380454 Xenopus laevis
422462 Gallus gallus
361390 Rattus norvegicus

Protein level used designations for ABCE1

  • ATP-binding cassette, sub-family E (OABP), member 1
  • ABC transporter-related protein
  • RNaseL inhibitor-like protein
  • ATP-binding cassette, sub-family E, member 1
  • ATP-binding cassette sub-family E member 1-like
  • RNAse L inhibitor
  • RNase L inhibitor
  • 2'-5'-oligoadenylate-binding protein
  • ATP-binding cassette sub-family E member 1
  • huHP68
  • ribonuclease 4 inhibitor
  • ribonuclease L (2',5'-oligoisoadenylate synthetase-dependent) inhibitor
  • ATP-binding cassette, subfamily E, member 1
  • RNS4I
  • RNS4l (Eye)
  • ribonuclease L (2', 5'-oligoisoadenylate synthetase-dependent) inhibitor
Other products related to ABCE1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website