ABCG1 (ATP-Binding Cassette, Sub-Family G (WHITE), Member 1, ABCG1)

Short Description: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the White subfamily. It is involved in macrophage cholesterol and phospholipids transport, and may regulate cellular lipid homeostasis in other cell types. Six alternative splice variants have been identified. [provided by RefSeq, Jul 2008].
More information related to gene ABCG1.
Products related to ABCG1 Gene:
Type
  • 115
  • 3
Species
  • 65
  • 26
  • 25
  • 2
Application
  • 80
  • 21
  • 16
  • 16
Fusion tag
  • 34
  • 23
  • 20
  • 9
  • 8
Vector Backbone
  • 13
  • 11
  • 11
  • 6
  • 6
Vector
  • 45
  • 44
  • 12
  • 9
  • 4
Insert
  • 45
  • 36
  • 18
  • 8
  • 6
Oligo-Type
  • 3
Resistance Gene
  • 45
  • 42
  • 28
  • 2
Expression Type
  • 110
  • 56
Selectable Marker
  • 36
  • 26
  • 1
Promoter
  • 53
  • 28
  • 14
  • 13
  • 8
Format
  • 60
  • 24
  • 22
  • 12
118 Products

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 1 (ABCG1)
Gene ID:
556979 (Zebrafish (Danio rerio), ABCG1)
Synonyms:
ABCG1, abcg1, Abcg1
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4065797
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 1 (ABCG1)
Gene ID:
556979 (Zebrafish (Danio rerio), ABCG1)
Synonyms:
ABCG1, abcg1, Abcg1
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4065798
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 1 (ABCG1)
Gene ID:
9619 (Human, ABCG1)
Synonyms:
ABCG1, abcg1, Abcg1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3806567
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 1 (ABCG1)
Gene ID:
11307 (Mouse, ABCG1)
Synonyms:
ABCG1, abcg1, Abcg1
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3987542
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 1 (ABCG1)
Gene ID:
9619 (Human, ABCG1)
Synonyms:
ABCG1, abcg1, Abcg1
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR221
Resistance Gene:
Kanamycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3427331
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 1 (ABCG1)
Gene ID:
9619 (Human, ABCG1)
Synonyms:
ABCG1, abcg1, Abcg1
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR221
Resistance Gene:
Kanamycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3427467
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 1 (ABCG1)
Gene ID:
9619 (Human, ABCG1)
Synonyms:
ABCG1, abcg1, Abcg1
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR221
Resistance Gene:
Kanamycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3419181
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 1 (ABCG1)
Gene ID:
9619 (Human, ABCG1)
Synonyms:
ABCG1, abcg1, Abcg1
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR221
Resistance Gene:
Kanamycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3425111
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 1 (ABCG1)
NCBI Accession:
NM_004915
Species:
Human
Synonyms:
ABCG1, abcg1, Abcg1
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ABCG1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5113384
$420.00
300 μL
Plus shipping costs $45.00 and $24.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 1 (ABCG1)
NCBI Accession:
NM_053502
Species:
Rat
Synonyms:
ABCG1, abcg1, Abcg1
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Abcg1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5113388
$420.00
300 μL
Plus shipping costs $45.00 and $24.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 1 (ABCG1)
NCBI Accession:
NM_009593
Species:
Mouse
Synonyms:
ABCG1, abcg1, Abcg1
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Abcg1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5113386
$420.00
300 μL
Plus shipping costs $45.00 and $24.00 dry ice
Available

Type:
ORF
Application:
Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 1 (ABCG1)
NCBI Accession:
NM_016818,NP_058198
Species:
Human
Synonyms:
ABCG1, abcg1, Abcg1
Insert length:
2001 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5391537
$433.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 1 (ABCG1)
NCBI Accession:
NM_016818,NP_058198
Species:
Human
Synonyms:
ABCG1, abcg1, Abcg1
Insert length:
2200 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948184

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3388035
$433.00
10 μg
Plus shipping costs $45.00
Will be delivered in 31 Business Days

Application:
RNA Interference
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 1
Species:
Human
Synonyms:
ABCG1, zgc:162197, ABC8, WHITE1, AW413978, Abc8, White
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • ABCG1 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3346159
$440.00
1 kit
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Application:
RNA Interference
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 1
Species:
Mouse
Synonyms:
ABCG1, zgc:162197, ABC8, WHITE1, AW413978, Abc8, White
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Abcg1 (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3266416
$440.00
1 kit
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Application:
RNA Interference
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 1
Species:
Rat
Synonyms:
ABCG1, zgc:162197, ABC8, WHITE1, AW413978, Abc8, White
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Abcg1 (Rat) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3352649
$440.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 1 (ABCG1)
Species:
Human
Synonyms:
ABCG1, abcg1, Abcg1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC-GFP
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
GFP tag
Expression:
Stable, Transient

Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5391531
$470.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 1 (ABCG1)
NCBI Accession:
NM_207629,NP_997512
Species:
Human
Synonyms:
ABCG1, abcg1, Abcg1
Insert length:
1992 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5391539
$494.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 1 (ABCG1)
Gene ID:
9619 (Human, ABCG1)
Synonyms:
ABCG1, abcg1, Abcg1
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter, U6 Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable

Viral particles:
ABIN5065464

Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN5046519
$503.00
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 1 (ABCG1)
NCBI Accession:
NM_004915
Species:
Human
Synonyms:
ABCG1, abcg1, Abcg1
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ABCG1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5228718
$520.00
300 μL
Plus shipping costs $45.00 and $24.00 dry ice
Available
  • <
  • 1

Synonyms and alternative names related to ABCG1

  • ATP binding cassette subfamily G member 1 (ABCG1)
  • ATP-binding cassette, sub-family G (WHITE), member 1 (abcg1)
  • ATP binding cassette subfamily G member 1 (Abcg1)
  • ABC8
  • Abc8
  • ABCG1
  • AW413978
  • White
  • WHITE1
  • zgc:162197

Gene-IDs for different species

GENE IDSPECIES
418533 Gallus gallus
458577 Pan troglodytes
487777 Canis lupus familiaris
510745 Bos taurus
556979 Danio rerio
100014129 Monodelphis domestica
100058103 Equus caballus
100077803 Ornithorhynchus anatinus
100470191 Ailuropoda melanoleuca
9619 Homo sapiens
11307 Mus musculus
85264 Rattus norvegicus

Protein level used designations for ABCG1

  • ATP-binding cassette sub-family G member 1
  • ATP-binding cassette, sub-family G (WHITE), member 1
  • ATP-binding cassette sub-family G member 1-like
  • ABC transporter 8
  • ATP-binding cassette transporter 8
  • ATP-binding cassette transporter member 1 of subfamily G
  • homolog of Drosophila white
  • white protein homolog (ATP-binding cassette transporter 8)
  • ATP-binding cassette 8
  • ATP-binding cassette, subfamily G, member 1
  • white protein homolog
Other products related to ABCG1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com