ABCG1 (ATP-Binding Cassette, Sub-Family G (WHITE), Member 1, ABCG1)

Short Description: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the White subfamily. It is involved in macrophage cholesterol and phospholipids transport, and may regulate cellular lipid homeostasis in other cell types. Six alternative splice variants have been identified. [provided by RefSeq, Jul 2008].
More information related to gene ABCG1.
Products related to ABCG1 Gene:
124 Products
  • 119
  • 5
  • 68
  • 29
  • 25
  • 2
  • 5
  • 45
  • 38
  • 20
  • 8
  • 6
  • 47
  • 45
  • 12
  • 9
  • 4
Vector Backbone
  • 13
  • 11
  • 11
  • 6
  • 6
Fusion tag
  • 38
  • 25
  • 20
  • 9
  • 8
Resistance Gene
  • 48
  • 43
  • 28
  • 2
Selectable Marker
  • 38
  • 26
  • 2
  • 55
  • 30
  • 14
  • 14
  • 8
Expression Type
  • 113
  • 58
  • 81
  • 25
  • 18
  • 16
  • 64
  • 24
  • 22
  • 14
Supplier: Log in to see

Full length Danio rerio ATP-binding cassette, sub-family G (WHITE), member 1 cDNA clone.

Protein Expression, Cloning
ATP-Binding Cassette, Sub-Family G (WHITE), Member 1 (ABCG1)
Gene ID:
556979 (Zebrafish (Danio rerio), ABCG1)
ABCG1, abcg1, Abcg1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4065797
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Homo sapiens ATP-binding cassette, sub-family G (WHITE), member 1 cDNA clone.

Protein Expression, Cloning
ATP-Binding Cassette, Sub-Family G (WHITE), Member 1 (ABCG1)
Gene ID:
9619 (Human, ABCG1)
ABCG1, abcg1, Abcg1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3806565
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Mus musculus ATP-binding cassette, sub-family G (WHITE), member 1 cDNA clone.

ATP-Binding Cassette, Sub-Family G (WHITE), Member 1 (ABCG1)
Gene ID:
11307 (Mouse (Murine), ABCG1)
ABCG1, abcg1, Abcg1
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3987541
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Danio rerio ATP-binding cassette, sub-family G (WHITE), member 1 cDNA clone.

Protein Expression, Cloning
ATP-Binding Cassette, Sub-Family G (WHITE), Member 1 (ABCG1)
Gene ID:
556979 (Zebrafish (Danio rerio), ABCG1)
ABCG1, abcg1, Abcg1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4065798
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens ATP-binding cassette, sub-family G (WHITE), member 1 cDNA clone.

Protein Expression, Cloning
ATP-Binding Cassette, Sub-Family G (WHITE), Member 1 (ABCG1)
Gene ID:
9619 (Human, ABCG1)
ABCG1, abcg1, Abcg1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3806567
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Mus musculus ATP-binding cassette, sub-family G (WHITE), member 1 cDNA clone.

ATP-Binding Cassette, Sub-Family G (WHITE), Member 1 (ABCG1)
Gene ID:
11307 (Mouse (Murine), ABCG1)
ABCG1, abcg1, Abcg1
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3987542
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human ABCG1 is ideal for over-expression of native protein for functional studies.

Protein Expression
ATP-Binding Cassette, Sub-Family G (WHITE), Member 1 (ABCG1)
NCBI Accession:
ABCG1, abcg1, Abcg1
Insert length:
2200 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
Catalog No. ABIN3388035
10 μg
Plus shipping costs $45.00
Will be delivered in 31 Business Days
Supplier: Log in to see

The ATP-binding cassette, sub-family G (WHITE), member 1 ORF clone is provided in a Gateway adapted entry vector for fast and convenient transfer to any compatible expression vector.

Protein Expression
ATP-Binding Cassette, Sub-Family G (WHITE), Member 1 (ABCG1)
Gene ID:
9619 (Human, ABCG1)
ABCG1, abcg1, Abcg1
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3419181
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

The ATP-binding cassette, sub-family G (WHITE), member 1 ORF clone is provided in a Gateway adapted entry vector for fast and convenient transfer to any compatible expression vector.

Protein Expression
ATP-Binding Cassette, Sub-Family G (WHITE), Member 1 (ABCG1)
Gene ID:
9619 (Human, ABCG1)
ABCG1, abcg1, Abcg1
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3427331
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

The ATP-binding cassette, sub-family G (WHITE), member 1 ORF clone is provided in a Gateway adapted entry vector for fast and convenient transfer to any compatible expression vector.

Protein Expression
ATP-Binding Cassette, Sub-Family G (WHITE), Member 1 (ABCG1)
Gene ID:
9619 (Human, ABCG1)
ABCG1, abcg1, Abcg1
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3427467
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

The ATP-binding cassette, sub-family G (WHITE), member 1 ORF clone is provided in a Gateway adapted entry vector for fast and convenient transfer to any compatible expression vector.

Protein Expression
ATP-Binding Cassette, Sub-Family G (WHITE), Member 1 (ABCG1)
Gene ID:
9619 (Human, ABCG1)
ABCG1, abcg1, Abcg1
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3425111
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

siRNA (27 mer) kit with 3 gene-specific unique siRNA duplexes and negative control for gene knockdown.

RNA Interference
ATP-Binding Cassette, Sub-Family G (WHITE), Member 1
ABCG1, zgc:162197, ABC8, WHITE1, AW413978, Abc8, White
HPLC purified
Available with shipment
  • ABCG1 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
-20 °C
Catalog No. ABIN3346159
1 kit
Plus shipping costs $45.00
Delivery in 8 to 11 Business Days
Supplier: Log in to see

siRNA (27 mer) kit with 3 gene-specific unique siRNA duplexes and negative control for gene knockdown.

RNA Interference
ATP-Binding Cassette, Sub-Family G (WHITE), Member 1
Rat (Rattus)
ABCG1, zgc:162197, ABC8, WHITE1, AW413978, Abc8, White
HPLC purified
Available with shipment
  • Abcg1 (Rat) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
-20 °C
Catalog No. ABIN3352649
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

siRNA (27 mer) kit with 3 gene-specific unique siRNA duplexes and negative control for gene knockdown.

RNA Interference
ATP-Binding Cassette, Sub-Family G (WHITE), Member 1
Mouse (Murine)
ABCG1, zgc:162197, ABC8, WHITE1, AW413978, Abc8, White
HPLC purified
Available with shipment
  • Abcg1 (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
-20 °C
Catalog No. ABIN3266416
1 kit
Plus shipping costs $45.00
Delivery in 8 to 11 Business Days
Supplier: Log in to see

Individual gRNA against Abcg1 in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Genome Editing with Engineered Nucleases, Protein Expression
ATP-Binding Cassette, Sub-Family G (WHITE), Member 1 (ABCG1)
NCBI Accession:
Mouse (Murine)
ABCG1, abcg1, Abcg1
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Abcg1
Viral Particles
-80 °C
Catalog No. ABIN5113386
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Supplier: Log in to see

Individual gRNA against Abcg1 in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Genome Editing with Engineered Nucleases, Protein Expression
ATP-Binding Cassette, Sub-Family G (WHITE), Member 1 (ABCG1)
NCBI Accession:
Rat (Rattus)
ABCG1, abcg1, Abcg1
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Abcg1
Viral Particles
-80 °C
Catalog No. ABIN5113388
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Supplier: Log in to see

Individual gRNA against ABCG1 in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Genome Editing with Engineered Nucleases, Protein Expression
ATP-Binding Cassette, Sub-Family G (WHITE), Member 1 (ABCG1)
NCBI Accession:
ABCG1, abcg1, Abcg1
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ABCG1
Viral Particles
-80 °C
Catalog No. ABIN5113384
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Supplier: Log in to see

siRNA to inhibit ABCG1 expression using RNA interference.

RNA Interference
ATP-Binding Cassette, Sub-Family G (WHITE), Member 1
Gene ID:
11307 (Mouse (Murine), ABCG1)
ABCG1, zgc:162197, ABC8, WHITE1, AW413978, Abc8, White
Oligonucleotide synthesis is monitored base by base through trityl analysis to ensure appropriate coupling efficiency. The oligo is subsequently purified by affinity-solid phase extraction. The annealed RNA duplex is further analyzed by mass spectrometry to verify the exact composition of the duplex. Each lot is compared to the previous lot by mass spectrometry to ensure maximum lot-to-lot consistency.
This product is provided as two 5 nmol vials (10 nmol), three 5 nmol vials (15 nmol) or 2x three 5 nmol vials (30 nmol) of lyophilized siRNA oligo duplexes. Each vial contains slightly different sequences to ensure full knockout of the gene. Each vial contains slightly different sequences to ensure full knockout of the gene. The duplexes can be transfected individually or pooled together to achieve knockdown of the target gene, which is most commonly assessed by qPCR or western blot. The siRNA oligos are also chemically modified (2'-OMe) for increased stability and enhanced knockdown in vitro and in vivo.
-20 °C
Catalog No. ABIN5789240
15 nmol
Plus shipping costs $45.00
Delivery in 16 to 26 Business Days
Supplier: Log in to see

siRNA to inhibit ABCG1 expression using RNA interference.

RNA Interference
ATP-Binding Cassette, Sub-Family G (WHITE), Member 1
Gene ID:
9619 (Human, ABCG1)
ABCG1, zgc:162197, ABC8, WHITE1, AW413978, Abc8, White
Oligonucleotide synthesis is monitored base by base through trityl analysis to ensure appropriate coupling efficiency. The oligo is subsequently purified by affinity-solid phase extraction. The annealed RNA duplex is further analyzed by mass spectrometry to verify the exact composition of the duplex. Each lot is compared to the previous lot by mass spectrometry to ensure maximum lot-to-lot consistency.
This product is provided as two 5 nmol vials (10 nmol), three 5 nmol vials (15 nmol) or 2x three 5 nmol vials (30 nmol) of lyophilized siRNA oligo duplexes. Each vial contains slightly different sequences to ensure full knockout of the gene. Each vial contains slightly different sequences to ensure full knockout of the gene. The duplexes can be transfected individually or pooled together to achieve knockdown of the target gene, which is most commonly assessed by qPCR or western blot. The siRNA oligos are also chemically modified (2'-OMe) for increased stability and enhanced knockdown in vitro and in vivo.
-20 °C
Catalog No. ABIN5789241
15 nmol
Plus shipping costs $45.00
Delivery in 16 to 26 Business Days
Supplier: Log in to see

transEDIT-dual CRISPR target gene set - with 3 vectors containing two gRNAs in each vector plus a negative control (glycerol stock)

Genome Editing with Engineered Nucleases
ATP-Binding Cassette, Sub-Family G (WHITE), Member 1 (ABCG1)
Gene ID:
9619 (Human, ABCG1)
ABCG1, abcg1, Abcg1
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
SFFV Promoter, U6 Promoter
Fusion Tag:
Transient, Stable

Viral particles:

- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Glycerol Stock
-80 °C
Catalog No. ABIN5046519
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days
  • <
  • 1

Synonyms and alternative names related to ABCG1

  • ATP binding cassette subfamily G member 1 (ABCG1)
  • ATP-binding cassette, sub-family G (WHITE), member 1 (abcg1)
  • ATP binding cassette subfamily G member 1 (Abcg1)
  • ABC8
  • Abc8
  • ABCG1
  • AW413978
  • White
  • WHITE1
  • zgc:162197

Gene-IDs for different species

418533 Gallus gallus
458577 Pan troglodytes
487777 Canis lupus familiaris
510745 Bos taurus
556979 Danio rerio
100014129 Monodelphis domestica
100058103 Equus caballus
100077803 Ornithorhynchus anatinus
100470191 Ailuropoda melanoleuca
9619 Homo sapiens
11307 Mus musculus
85264 Rattus norvegicus

Protein level used designations for ABCG1

  • ATP-binding cassette sub-family G member 1
  • ATP-binding cassette, sub-family G (WHITE), member 1
  • ATP-binding cassette sub-family G member 1-like
  • ABC transporter 8
  • ATP-binding cassette transporter 8
  • ATP-binding cassette transporter member 1 of subfamily G
  • homolog of Drosophila white
  • white protein homolog (ATP-binding cassette transporter 8)
  • ATP-binding cassette 8
  • ATP-binding cassette, subfamily G, member 1
  • white protein homolog
Other products related to ABCG1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website