ABCG8 (ATP-Binding Cassette, Sub-Family G (WHITE), Member 8, ABCG8)

Short Description: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the White subfamily. The protein encoded by this gene functions to exclude non-cholesterol sterol entry at the intestinal level, promote excretion of cholesterol and sterols into bile, and to facilitate transport of sterols back into the intestinal lumen. It is expressed in a tissue-specific manner in the liver, intestine, and gallbladder. This gene is tandemly arrayed on chromosome 2, in a head-to-head orientation with family member ABCG5. Mutations in this gene may contribute to sterol accumulation and atherosclerosis, and have been observed in patients with sitosterolemia. [provided by RefSeq, Jul 2008].
More information related to gene ABCG8.
Products related to ABCG8 Gene:
100 Products
Type
  • 95
  • 5
Species
  • 39
  • 32
  • 27
  • 2
Application
  • 49
  • 26
  • 23
  • 16
Fusion tag
  • 37
  • 16
  • 10
  • 9
  • 8
Vector Backbone
  • 8
  • 6
  • 6
  • 6
  • 6
Vector
  • 36
  • 27
  • 12
  • 9
  • 8
Insert
  • 38
  • 21
  • 20
  • 8
  • 6
Oligo-Type
  • 5
Resistance Gene
  • 39
  • 35
  • 18
  • 3
  • 2
Expression Type
  • 84
  • 50
Selectable Marker
  • 34
  • 26
  • 1
Promoter
  • 31
  • 31
  • 13
  • 9
  • 8
Format
  • 37
  • 24
  • 22
  • 17

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 8 (ABCG8)
Gene ID:
100136850 (Zebrafish (Danio rerio), ABCG8)
Synonyms:
ABCG8, PTRG_02054, abcG8, abcg8, Abcg8
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4070900
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 8 (ABCG8)
Gene ID:
64241 (Human, ABCG8)
Synonyms:
ABCG8, PTRG_02054, abcG8, abcg8, Abcg8
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4007077
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 8 (ABCG8)
Gene ID:
67470 (Mouse (Murine), ABCG8)
Synonyms:
ABCG8, PTRG_02054, abcG8, abcg8, Abcg8
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4007521
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 8 (ABCG8)
Gene ID:
67470 (Mouse (Murine), ABCG8)
Synonyms:
ABCG8, PTRG_02054, abcG8, abcg8, Abcg8
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4007522
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 8 (ABCG8)
Gene ID:
64241 (Human, ABCG8)
Synonyms:
ABCG8, PTRG_02054, abcG8, abcg8, Abcg8
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4007080
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 8 (ABCG8)
Gene ID:
100136850 (Zebrafish (Danio rerio), ABCG8)
Synonyms:
ABCG8, PTRG_02054, abcG8, abcg8, Abcg8
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4070899
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 8 (ABCG8)
Gene ID:
64241 (Human, ABCG8)
Synonyms:
ABCG8, PTRG_02054, abcG8, abcg8, Abcg8
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4007079
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 8 (ABCG8)
Gene ID:
64241 (Human, ABCG8)
Synonyms:
ABCG8, PTRG_02054, abcG8, abcg8, Abcg8
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4007078
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 8 (ABCG8)
Gene ID:
67470 (Mouse (Murine), ABCG8)
Synonyms:
ABCG8, PTRG_02054, abcG8, abcg8, Abcg8
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4007520
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 8 (ABCG8)
Gene ID:
67470 (Mouse (Murine), ABCG8)
Synonyms:
ABCG8, PTRG_02054, abcG8, abcg8, Abcg8
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4007519
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 8 (ABCG8)
Gene ID:
64241 (Human, ABCG8)
Synonyms:
ABCG8, PTRG_02054, abcG8, abcg8, Abcg8
Insert length:
2022 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5324507
$204.60
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 8 (ABCG8)
Gene ID:
64241 (Human, ABCG8)
Synonyms:
ABCG8, PTRG_02054, abcG8, abcg8, Abcg8
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3428206
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 8 (ABCG8)
Gene ID:
64241 (Human, ABCG8)
Synonyms:
ABCG8, PTRG_02054, abcG8, abcg8, Abcg8
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3414742
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Application:
RNA Interference
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 8
Species:
Rat (Rattus)
Synonyms:
DDBDRAFT_0167690, DDBDRAFT_0191232, DDB_0167690, DDB_0191232, zgc:172358, GBD4, STSL, 1300003C16Rik, AI114946, sterolin-2
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Abcg8 (Rat) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3359213
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 8
Species:
Mouse (Murine)
Synonyms:
DDBDRAFT_0167690, DDBDRAFT_0191232, DDB_0167690, DDB_0191232, zgc:172358, GBD4, STSL, 1300003C16Rik, AI114946, sterolin-2
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Abcg8 (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3266502
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 8 (ABCG8)
NCBI Accession:
NM_026180
Species:
Mouse (Murine)
Synonyms:
ABCG8, PTRG_02054, abcG8, abcg8, Abcg8
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Abcg8
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5113410
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 8 (ABCG8)
NCBI Accession:
NM_022437
Species:
Human
Synonyms:
ABCG8, PTRG_02054, abcG8, abcg8, Abcg8
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ABCG8
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5113408
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 8 (ABCG8)
NCBI Accession:
NM_130414
Species:
Rat (Rattus)
Synonyms:
ABCG8, PTRG_02054, abcG8, abcg8, Abcg8
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Abcg8
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5113412
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
ORF
Application:
Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 8 (ABCG8)
NCBI Accession:
NM_022437,NP_071882
Species:
Human
Synonyms:
ABCG8, PTRG_02054, abcG8, abcg8, Abcg8
Insert length:
2022 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5391586
$430.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 8 (ABCG8)
Species:
Human
Synonyms:
ABCG8, PTRG_02054, abcG8, abcg8, Abcg8
Insert length:
2022 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4483702
$450.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to ABCG8

  • ATP binding cassette subfamily G member 8 (ABCG8)
  • ATP-binding cassette sub-family G member 8 (PTRG_02054)
  • ABC transporter G family protein (abcG8)
  • ATP-binding cassette, sub-family G (WHITE), member 8 (abcg8)
  • ATP binding cassette subfamily G member 8 (Abcg8)
  • 1300003C16Rik
  • AI114946
  • DDBDRAFT_0167690
  • DDBDRAFT_0191232
  • DDB_0167690
  • DDB_0191232
  • GBD4
  • sterolin-2
  • STSL
  • zgc:172358

Gene-IDs for different species

GENE IDSPECIES
100069071 Equus caballus
421402 Gallus gallus
470363 Pan troglodytes
6338845 Pyrenophora tritici-repentis Pt-1C-BFP
8619568 Dictyostelium discoideum AX4
100033372 Monodelphis domestica
100136850 Danio rerio
100350554 Oryctolagus cuniculus
100402530 Callithrix jacchus
100445033 Pongo abelii
100466630 Ailuropoda melanoleuca
100601594 Nomascus leucogenys
64241 Homo sapiens
67470 Mus musculus
474571 Canis lupus familiaris
100048963 Sus scrofa
508829 Bos taurus
155192 Rattus norvegicus

Protein level used designations for ABCG8

  • ATP-binding cassette, sub-family G (WHITE), member 8 (sterolin 2)
  • sterolin 2
  • ATP-binding cassette sub-family G member 8
  • sterolin-2
  • ATP-binding cassette, sub-family G (WHITE), member 8
  • ATP-binding cassette sub-family G member 8-like
  • ATP-binding cassette, subfamily G, member 8
Other products related to ABCG8 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com