ABHD10 (Abhydrolase Domain Containing 10, ABHD10)

Short Description: This gene encodes a mitochondrially-localized enzyme that acts in liver cells as a hydrolase. The encoded protein removes glucuronide from mycophenolic acid acyl-glucuronide. There is a pseudogene for this gene on chromosome 6. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013].
More information related to gene ABHD10.
Products related to ABHD10 Gene:
135 Products
Type
  • 128
  • 7
Species
  • 57
  • 42
  • 30
  • 4
  • 2
Oligo-Type
  • 6
  • 1
Insert
  • 52
  • 39
  • 21
  • 8
  • 6
Vector
  • 61
  • 36
  • 12
  • 9
  • 6
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
Fusion tag
  • 45
  • 17
  • 13
  • 11
  • 8
Resistance Gene
  • 60
  • 43
  • 20
  • 5
  • 2
Selectable Marker
  • 28
  • 26
  • 26
  • 1
Promoter
  • 40
  • 34
  • 31
  • 12
  • 8
Expression Type
  • 95
  • 53
  • 26
  • 4
Application
  • 83
  • 28
  • 27
  • 16
  • 1
Format
  • 69
  • 27
  • 22
  • 17
Supplier: Log in to see

ORF Cloning-Vector holds the gene between an AflII and EcoRV cut site.

Type:
ORF
Application:
Cloning
Gene:
Abhydrolase Domain Containing 10 (ABHD10)
Species:
Human
Synonyms:
ABHD10, abhd10, Abhd10
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5731378
€39.82
1 μg
Plus shipping costs €45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens abhydrolase domain containing 10.

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 10 (ABHD10)
Species:
Human
Synonyms:
ABHD10, abhd10, Abhd10
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3545853
€66.37
1 vial
Plus shipping costs €45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Mus musculus abhydrolase domain containing 10.

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 10 (ABHD10)
NCBI Accession:
XM_006521975
Species:
Mouse (Murine)
Synonyms:
ABHD10, abhd10, Abhd10
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3545854
€66.37
1 vial
Plus shipping costs €45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Verified forward and reverse primers for analyzing the quantitative expression of gene

Application:
Quantitative real-time PCR
Gene:
Abhydrolase Domain Containing 10
Species:
Human
Synonyms:
ABHD10, RGD1308084
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3191422
€69.91
1 vial
Plus shipping costs €45.00
Delivery in 15 to 19 Business Days
Supplier: Log in to see

Full length Rattus norvegicus abhydrolase domain containing 10 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 10 (ABHD10)
Gene ID:
303953 (Rat (Rattus), ABHD10)
Synonyms:
ABHD10, abhd10, Abhd10
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4052066
€97.35
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Bos taurus abhydrolase domain containing 10 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 10 (ABHD10)
Gene ID:
515563 (Cow (Bovine), ABHD10)
Synonyms:
ABHD10, abhd10, Abhd10
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3859472
€97.35
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Homo sapiens abhydrolase domain containing 10 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 10 (ABHD10)
Gene ID:
55347 (Human, ABHD10)
Synonyms:
ABHD10, abhd10, Abhd10
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4091786
€97.35
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Rattus norvegicus abhydrolase domain containing 10 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 10 (ABHD10)
Gene ID:
303953 (Rat (Rattus), ABHD10)
Synonyms:
ABHD10, abhd10, Abhd10
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4052067
€136.67
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Bos taurus abhydrolase domain containing 10 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 10 (ABHD10)
Gene ID:
515563 (Cow (Bovine), ABHD10)
Synonyms:
ABHD10, abhd10, Abhd10
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3859471
€136.67
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens abhydrolase domain containing 10 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 10 (ABHD10)
Gene ID:
55347 (Human, ABHD10)
Synonyms:
ABHD10, abhd10, Abhd10
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4091787
€136.67
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human ABHD10 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Abhydrolase Domain Containing 10 (ABHD10)
NCBI Accession:
NM_018394,NP_060864
Species:
Human
Synonyms:
ABHD10, abhd10, Abhd10
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, Stable

Empty vector controls:
ABIN4948179

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3317183
€168.14
10 μg
Plus shipping costs €45.00
Delivery in 8 to 11 Business Days
Supplier: Log in to see

Entry clone of human cDNA (ORF) without STOP codon in Gateway pDONR223 Vector.

Type:
ORF
Application:
Cloning
Gene:
Abhydrolase Domain Containing 10 (ABHD10)
Gene ID:
55347 (Human, ABHD10)
Synonyms:
ABHD10, abhd10, Abhd10
Insert length:
921 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5314328
€172.15
2 μg
Plus shipping costs €45.00
Delivery in 15 to 17 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Abhd10 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Abhydrolase Domain Containing 10 (ABHD10)
NCBI Accession:
NM_001272070,NP_001258999
Species:
Mouse (Murine)
Synonyms:
ABHD10, abhd10, Abhd10
Insert length:
879 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3308369
€238.94
10 μg
Plus shipping costs €45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Bacterial expression of Human ABHD10 with His-MBP

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 10 (ABHD10)
Species:
Human
Synonyms:
ABHD10, abhd10, Abhd10
Insert length:
921 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4696812
€243.36
500 ng
Plus shipping costs €45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Human ABHD10 with His-GST

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 10 (ABHD10)
Species:
Human
Synonyms:
ABHD10, abhd10, Abhd10
Insert length:
921 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4825941
€243.36
500 ng
Plus shipping costs €45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Human ABHD10 with His tag

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 10 (ABHD10)
Species:
Human
Synonyms:
ABHD10, abhd10, Abhd10
Insert length:
921 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4758036
€243.36
500 ng
Plus shipping costs €45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Mammalian expression of Human ABHD10 with HA tag

Type:
cDNA
Application:
Protein Expression
Gene:
Abhydrolase Domain Containing 10 (ABHD10)
Species:
Human
Synonyms:
ABHD10, abhd10, Abhd10
Insert length:
921 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4372559
€243.36
500 ng
Plus shipping costs €45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Human ABHD10 with His tag

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 10 (ABHD10)
Species:
Human
Synonyms:
ABHD10, abhd10, Abhd10
Insert length:
921 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4372128
€243.36
500 ng
Plus shipping costs €45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Mammalian expression of Human ABHD10 with His tag

Type:
cDNA
Application:
Protein Expression
Gene:
Abhydrolase Domain Containing 10 (ABHD10)
Species:
Human
Synonyms:
ABHD10, abhd10, Abhd10
Insert length:
921 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4432756
€243.36
500 ng
Plus shipping costs €45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

The abhydrolase domain containing 10 ORF clone is provided in a Gateway adapted entry vector for fast and convenient transfer to any compatible expression vector.

Type:
ORF
Application:
Protein Expression
Gene:
Abhydrolase Domain Containing 10 (ABHD10)
Gene ID:
55347 (Human, ABHD10)
Synonyms:
ABHD10, abhd10, Abhd10
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3395793
€265.49
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
  • <
  • 1

Synonyms and alternative names related to ABHD10

  • abhydrolase domain containing 10 (ABHD10)
  • abhydrolase domain containing 10 (abhd10)
  • abhydrolase domain containing 10 (Abhd10)
  • ABHD10
  • RGD1308084

Gene-IDs for different species

GENE IDSPECIES
418419 Gallus gallus
478561 Canis lupus familiaris
707464 Macaca mulatta
743016 Pan troglodytes
100135182 Xenopus (Silurana) tropicalis
55347 Homo sapiens
213012 Mus musculus
303953 Rattus norvegicus
515563 Bos taurus
100171612 Pongo abelii
100733320 Cavia porcellus
101119354 Ovis aries

Protein level used designations for ABHD10

  • abhydrolase domain containing 10
  • abhydrolase domain-containing protein 10, mitochondrial
  • alpha/beta hydrolase domain-containing protein 10, mitochondrial
  • mycophenolic acid acyl-glucuronide esterase, mitochondrial
Other products related to ABHD10 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com