ABHD10 (Abhydrolase Domain Containing 10, ABHD10)

Short Description: This gene encodes a mitochondrially-localized enzyme that acts in liver cells as a hydrolase. The encoded protein removes glucuronide from mycophenolic acid acyl-glucuronide. There is a pseudogene for this gene on chromosome 6. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013].
More information related to gene ABHD10.
Products related to ABHD10 Gene:
  • 120
  • 4
  • 54
  • 40
  • 27
  • 2
  • 1
  • 79
  • 23
  • 21
  • 16
  • 1
Fusion tag
  • 37
  • 14
  • 13
  • 11
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
  • 54
  • 36
  • 12
  • 9
  • 5
  • 52
  • 34
  • 18
  • 8
  • 6
  • 3
  • 1
Resistance Gene
  • 57
  • 39
  • 19
  • 5
  • 2
Expression Type
  • 88
  • 50
  • 26
  • 2
Selectable Marker
  • 26
  • 26
  • 25
  • 1
  • 36
  • 31
  • 28
  • 12
  • 8
  • 63
  • 27
  • 22
  • 12
124 Products

Abhydrolase Domain Containing 10 (ABHD10)
ABHD10, abhd10, Abhd10
Insert length:
921 bp
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5731378
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Abhydrolase Domain Containing 10 (ABHD10)
NCBI Accession:
ABHD10, abhd10, Abhd10
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13(-21)
  • M13 rev
Catalog No. ABIN3545854
1 vial
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Abhydrolase Domain Containing 10 (ABHD10)
ABHD10, abhd10, Abhd10
Vector type:
TA-Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Catalog No. ABIN3545853
1 vial
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Abhydrolase Domain Containing 10 (ABHD10)
Gene ID:
55347 (Human, ABHD10)
ABHD10, abhd10, Abhd10
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4091787
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Abhydrolase Domain Containing 10 (ABHD10)
Gene ID:
515563 (Cow, ABHD10)
ABHD10, abhd10, Abhd10
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3859471
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Abhydrolase Domain Containing 10 (ABHD10)
Gene ID:
303953 (Rat, ABHD10)
ABHD10, abhd10, Abhd10
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4052067
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Quantitative real-time PCR
Abhydrolase Domain Containing 10
ABHD10, RGD1308084
-20 °C
Catalog No. ABIN3191422
1 vial
Plus shipping costs $45.00
Delivery in 12 to 16 Business Days

Abhydrolase Domain Containing 10 (ABHD10)
Gene ID:
55347 (Human, ABHD10)
ABHD10, abhd10, Abhd10
Insert length:
921 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
2 μg of lyophilized gene in pDONR223 vector
-20 °C
Catalog No. ABIN5314328
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Abhydrolase Domain Containing 10 (ABHD10)
ABHD10, abhd10, Abhd10
Insert length:
921 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4696812
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Abhydrolase Domain Containing 10 (ABHD10)
ABHD10, abhd10, Abhd10
Insert length:
921 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4825941
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Abhydrolase Domain Containing 10 (ABHD10)
ABHD10, abhd10, Abhd10
Insert length:
921 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4372128
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Abhydrolase Domain Containing 10 (ABHD10)
ABHD10, abhd10, Abhd10
Insert length:
921 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4758036
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Protein Expression
Abhydrolase Domain Containing 10 (ABHD10)
ABHD10, abhd10, Abhd10
Insert length:
921 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
HA tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4372559
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Protein Expression
Abhydrolase Domain Containing 10 (ABHD10)
ABHD10, abhd10, Abhd10
Insert length:
921 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
His tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4432756
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Protein Expression
Abhydrolase Domain Containing 10 (ABHD10)
Gene ID:
55347 (Human, ABHD10)
ABHD10, abhd10, Abhd10
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • pDONR201-forward
Glycerol Stock
-80 °C
Catalog No. ABIN3407119
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression
Abhydrolase Domain Containing 10 (ABHD10)
Gene ID:
55347 (Human, ABHD10)
ABHD10, abhd10, Abhd10
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3395793
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression
Abhydrolase Domain Containing 10 (ABHD10)
NCBI Accession:
ABHD10, abhd10, Abhd10
Insert length:
879 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
Catalog No. ABIN3308369
10 μg
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Genome Editing with Engineered Nucleases, Protein Expression
Abhydrolase Domain Containing 10 (ABHD10)
NCBI Accession:
ABHD10, abhd10, Abhd10
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Abhd10
Viral Particles
-80 °C
Catalog No. ABIN5101543
300 μL
Plus shipping costs $45.00 and $24.00 dry ice

Genome Editing with Engineered Nucleases, Protein Expression
Abhydrolase Domain Containing 10 (ABHD10)
NCBI Accession:
ABHD10, abhd10, Abhd10
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Abhd10
Viral Particles
-80 °C
Catalog No. ABIN5101545
300 μL
Plus shipping costs $45.00 and $24.00 dry ice

Genome Editing with Engineered Nucleases, Protein Expression
Abhydrolase Domain Containing 10 (ABHD10)
NCBI Accession:
ABHD10, abhd10, Abhd10
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ABHD10
Viral Particles
-80 °C
Catalog No. ABIN5101541
300 μL
Plus shipping costs $45.00 and $24.00 dry ice
  • <
  • 1

Synonyms and alternative names related to ABHD10

  • abhydrolase domain containing 10 (ABHD10)
  • abhydrolase domain containing 10 (abhd10)
  • abhydrolase domain containing 10 (Abhd10)
  • ABHD10
  • RGD1308084

Gene-IDs for different species

418419 Gallus gallus
478561 Canis lupus familiaris
707464 Macaca mulatta
743016 Pan troglodytes
100135182 Xenopus (Silurana) tropicalis
55347 Homo sapiens
213012 Mus musculus
303953 Rattus norvegicus
515563 Bos taurus
100171612 Pongo abelii
100733320 Cavia porcellus
101119354 Ovis aries

Protein level used designations for ABHD10

  • abhydrolase domain containing 10
  • abhydrolase domain-containing protein 10, mitochondrial
  • alpha/beta hydrolase domain-containing protein 10, mitochondrial
  • mycophenolic acid acyl-glucuronide esterase, mitochondrial
Other products related to ABHD10 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com