ABHD14A (Abhydrolase Domain Containing 14A, ABHD14A)

Short Description: Possible role in granule neuron development (By similarity).
More information related to gene ABHD14A.
Products related to ABHD14A Gene:
154 Products
Type
  • 148
  • 6
Species
  • 67
  • 55
  • 30
  • 2
Application
  • 94
  • 36
  • 25
  • 16
  • 1
Fusion tag
  • 44
  • 19
  • 19
  • 14
  • 9
Vector Backbone
  • 10
  • 10
  • 6
  • 6
  • 6
Vector
  • 62
  • 44
  • 20
  • 9
  • 8
Insert
  • 60
  • 52
  • 20
  • 8
  • 6
Oligo-Type
  • 5
  • 1
Resistance Gene
  • 74
  • 39
  • 28
  • 7
  • 2
Expression Type
  • 114
  • 57
  • 26
Selectable Marker
  • 31
  • 26
  • 26
  • 1
Promoter
  • 46
  • 37
  • 30
  • 21
  • 8
Format
  • 67
  • 45
  • 26
  • 16
Supplier: Log in to see

ORF Cloning-Vector holds the gene between an AflII and EcoRV cut site.

Type:
ORF
Application:
Cloning
Gene:
Abhydrolase Domain Containing 14A (ABHD14A)
Species:
Human
Synonyms:
ABHD14A, ACY1, Abhd14a, abhd14a
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5746245
$70.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Mammalian Vector with ORF clone of Human abhydrolase domain containing 14A (ABHD14A)

Type:
ORF
Application:
Protein Expression
Gene:
Abhydrolase Domain Containing 14A (ABHD14A)
NCBI Accession:
NM_015407,NP_056222
Species:
Human
Synonyms:
ABHD14A, ACY1, Abhd14a, abhd14a
Insert length:
816 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5420171
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see

Full length Danio rerio abhydrolase domain containing 14A cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 14A (ABHD14A)
Gene ID:
404598 (Zebrafish (Danio rerio), ABHD14A)
Synonyms:
ABHD14A, ACY1, Abhd14a, abhd14a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6.1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3877813
$99.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Mus musculus abhydrolase domain containing 14A cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 14A (ABHD14A)
Gene ID:
68644 (Mouse (Murine), ABHD14A)
Synonyms:
ABHD14A, ACY1, Abhd14a, abhd14a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3822577
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Rattus norvegicus abhydrolase domain containing 14A cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 14A (ABHD14A)
Gene ID:
300982 (Rat (Rattus), ABHD14A)
Synonyms:
ABHD14A, ACY1, Abhd14a, abhd14a
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4051635
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Homo sapiens abhydrolase domain containing 14A cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 14A (ABHD14A)
Gene ID:
25864 (Human, ABHD14A)
Synonyms:
ABHD14A, ACY1, Abhd14a, abhd14a
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4090055
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Clone DNA of Mus musculus abhydrolase domain containing 14A.

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 14A (ABHD14A)
Species:
Mouse (Murine)
Synonyms:
ABHD14A, ACY1, Abhd14a, abhd14a
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3545861
$125.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens abhydrolase domain containing 14A.

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 14A (ABHD14A)
Species:
Human
Synonyms:
ABHD14A, ACY1, Abhd14a, abhd14a
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3545860
$125.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Verified forward and reverse primers for analyzing the quantitative expression of gene

Application:
Quantitative real-time PCR
Gene:
Abhydrolase Domain Containing 14A
Species:
Human
Synonyms:
DORZ1, 1110013B16Rik, AW558221, Dorz1, RGD1309721, zgc:85972
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3190366
$129.00
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Danio rerio abhydrolase domain containing 14A cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 14A (ABHD14A)
Gene ID:
404598 (Zebrafish (Danio rerio), ABHD14A)
Synonyms:
ABHD14A, ACY1, Abhd14a, abhd14a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3847229
$139.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Mus musculus abhydrolase domain containing 14A cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 14A (ABHD14A)
Gene ID:
68644 (Mouse (Murine), ABHD14A)
Synonyms:
ABHD14A, ACY1, Abhd14a, abhd14a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3822578
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Rattus norvegicus abhydrolase domain containing 14A cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 14A (ABHD14A)
Gene ID:
300982 (Rat (Rattus), ABHD14A)
Synonyms:
ABHD14A, ACY1, Abhd14a, abhd14a
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4051634
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens abhydrolase domain containing 14A cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 14A (ABHD14A)
Gene ID:
25864 (Human, ABHD14A)
Synonyms:
ABHD14A, ACY1, Abhd14a, abhd14a
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4090056
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Entry clone of human cDNA (ORF) without STOP codon in Gateway pDONR223 Vector.

Type:
ORF
Application:
Cloning
Gene:
Abhydrolase Domain Containing 14A (ABHD14A)
Gene ID:
25864 (Human, ABHD14A)
Synonyms:
ABHD14A, ACY1, Abhd14a, abhd14a
Insert length:
816 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5313364
$194.53
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
Supplier: Log in to see

Bacterial expression of Human ABHD14A with His tag

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 14A (ABHD14A)
Species:
Human
Synonyms:
ABHD14A, ACY1, Abhd14a, abhd14a
Insert length:
816 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4372133
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Mammalian expression of Human ABHD14A with His tag

Type:
cDNA
Application:
Protein Expression
Gene:
Abhydrolase Domain Containing 14A (ABHD14A)
Species:
Human
Synonyms:
ABHD14A, ACY1, Abhd14a, abhd14a
Insert length:
816 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4432761
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Mammalian expression of Human ABHD14A with HA tag

Type:
cDNA
Application:
Protein Expression
Gene:
Abhydrolase Domain Containing 14A (ABHD14A)
Species:
Human
Synonyms:
ABHD14A, ACY1, Abhd14a, abhd14a
Insert length:
816 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4471666
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Human ABHD14A with His-GST

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 14A (ABHD14A)
Species:
Human
Synonyms:
ABHD14A, ACY1, Abhd14a, abhd14a
Insert length:
816 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4825946
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Human ABHD14A with His tag

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 14A (ABHD14A)
Species:
Human
Synonyms:
ABHD14A, ACY1, Abhd14a, abhd14a
Insert length:
816 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4758041
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Human ABHD14A with His-MBP

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 14A (ABHD14A)
Species:
Human
Synonyms:
ABHD14A, ACY1, Abhd14a, abhd14a
Insert length:
816 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4696817
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to ABHD14A

  • abhydrolase domain containing 14A (ABHD14A)
  • aminoacylase 1 (ACY1)
  • abhydrolase domain containing 14A (Abhd14a)
  • abhydrolase domain containing 14A (abhd14a)
  • 1110013B16Rik
  • AW558221
  • DORZ1
  • Dorz1
  • RGD1309721
  • zgc:85972

Gene-IDs for different species

GENE IDSPECIES
484743 Canis lupus familiaris
515122 Bos taurus
698851 Macaca mulatta
25864 Homo sapiens
68644 Mus musculus
300982 Rattus norvegicus
404598 Danio rerio
100722756 Cavia porcellus
100858554 Gallus gallus
101114562 Ovis aries

Protein level used designations for ABHD14A

  • abhydrolase domain containing 14A
  • similar to aminoacylase 1
  • abhydrolase domain-containing protein 14A
  • alpha/beta hydrolase domain-containing protein 14A
  • down-regulated in Zic-1-mutant protein
  • down-regulated in Zic1 deficient cerebellar primordium
  • downregulated in Zic1 deficient cerebellum
Other products related to ABHD14A such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com