ABHD15 (Abhydrolase Domain Containing 15, ABHD15)

Products related to ABHD15 Gene:
Type
  • 67
  • 3
Species
  • 26
  • 23
  • 21
Application
  • 35
  • 21
  • 16
  • 11
Fusion tag
  • 25
  • 11
  • 8
  • 7
  • 6
Vector Backbone
  • 6
  • 6
  • 6
  • 4
  • 4
Vector
  • 31
  • 16
  • 9
  • 8
  • 2
Insert
  • 20
  • 18
  • 13
  • 8
  • 6
Oligo-Type
  • 3
Resistance Gene
  • 27
  • 23
  • 14
  • 3
  • 2
Expression Type
  • 66
  • 41
Selectable Marker
  • 26
  • 18
Promoter
  • 28
  • 18
  • 8
  • 8
  • 6
Format
  • 26
  • 20
  • 18
  • 6
70 Products

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 15 (ABHD15)
Gene ID:
116236 (Human, ABHD15)
Synonyms:
ABHD15, Abhd15
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3831482
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Abhydrolase Domain Containing 15 (ABHD15)
Gene ID:
116236 (Human, ABHD15)
Synonyms:
ABHD15, Abhd15
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3410170
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Abhydrolase Domain Containing 15 (ABHD15)
NCBI Accession:
NM_026185
Species:
Mouse
Synonyms:
ABHD15, Abhd15
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Abhd15
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5128476
$420.00
300 μL
Plus shipping costs $45.00 and $24.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Abhydrolase Domain Containing 15 (ABHD15)
NCBI Accession:
NM_001107025
Species:
Rat
Synonyms:
ABHD15, Abhd15
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Abhd15
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5128478
$420.00
300 μL
Plus shipping costs $45.00 and $24.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Abhydrolase Domain Containing 15 (ABHD15)
NCBI Accession:
NM_198147
Species:
Human
Synonyms:
ABHD15, Abhd15
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ABHD15
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5128474
$420.00
300 μL
Plus shipping costs $45.00 and $24.00 dry ice
Available

Type:
ORF
Application:
Protein Expression
Gene:
Abhydrolase Domain Containing 15 (ABHD15)
NCBI Accession:
NM_198147,NP_937790
Species:
Human
Synonyms:
ABHD15, Abhd15
Insert length:
1407 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5418524
$433.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Application:
RNA Interference
Gene:
Abhydrolase Domain Containing 15
Species:
Mouse
Synonyms:
1300007F04Rik, RGD1304598
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Abhd15 (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3270996
$440.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
Abhydrolase Domain Containing 15
Species:
Human
Synonyms:
1300007F04Rik, RGD1304598
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • ABHD15 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3311563
$440.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
Abhydrolase Domain Containing 15
Species:
Rat
Synonyms:
1300007F04Rik, RGD1304598
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • RGD1304598 (Rat) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3355391
$440.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Abhydrolase Domain Containing 15 (ABHD15)
Species:
Human
Synonyms:
ABHD15, Abhd15
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC-GFP
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
GFP tag
Expression:
Stable, Transient

Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5418523
$470.00
10 μg
Plus shipping costs $45.00
Will be delivered in 31 Business Days

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Abhydrolase Domain Containing 15 (ABHD15)
Gene ID:
116236 (Human, ABHD15)
Synonyms:
ABHD15, Abhd15
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter, U6 Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable

Viral particles:
ABIN5048562

Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN5029617
$503.00
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Abhydrolase Domain Containing 15 (ABHD15)
NCBI Accession:
NM_198147
Species:
Human
Synonyms:
ABHD15, Abhd15
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ABHD15
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5243903
$520.00
300 μL
Plus shipping costs $45.00 and $24.00 dry ice
Available

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Abhydrolase Domain Containing 15 (ABHD15)
NCBI Accession:
NM_001107025
Species:
Rat
Synonyms:
ABHD15, Abhd15
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Abhd15
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5243907
$520.00
300 μL
Plus shipping costs $45.00 and $24.00 dry ice
Available

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Abhydrolase Domain Containing 15 (ABHD15)
NCBI Accession:
NM_026185
Species:
Mouse
Synonyms:
ABHD15, Abhd15
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Abhd15
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5243905
$520.00
300 μL
Plus shipping costs $45.00 and $24.00 dry ice
Available

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 15 (ABHD15)
NCBI Accession:
NM_001107025
Species:
Rat
Synonyms:
ABHD15, Abhd15
Insert length:
3098 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4741277
$570.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 15 (ABHD15)
NCBI Accession:
NM_001107025
Species:
Rat
Synonyms:
ABHD15, Abhd15
Insert length:
3098 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4680020
$570.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Abhydrolase Domain Containing 15 (ABHD15)
NCBI Accession:
NM_001107025
Species:
Rat
Synonyms:
ABHD15, Abhd15
Insert length:
3098 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-N-D-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag,HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4542481
$570.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Abhydrolase Domain Containing 15 (ABHD15)
NCBI Accession:
NM_001107025
Species:
Rat
Synonyms:
ABHD15, Abhd15
Insert length:
3098 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-N-D-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag,His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4603673
$570.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 15 (ABHD15)
NCBI Accession:
NM_026185
Species:
Mouse
Synonyms:
ABHD15, Abhd15
Insert length:
3249 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4716333
$570.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 15 (ABHD15)
NCBI Accession:
NM_026185
Species:
Mouse
Synonyms:
ABHD15, Abhd15
Insert length:
3249 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4845464
$570.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to ABHD15

  • abhydrolase domain containing 15 (ABHD15)
  • abhydrolase domain containing 15 (Abhd15)
  • 1300007F04Rik
  • RGD1304598

Gene-IDs for different species

GENE IDSPECIES
468200 Pan troglodytes
491179 Canis lupus familiaris
711493 Macaca mulatta
100025991 Monodelphis domestica
100399419 Callithrix jacchus
100455726 Pongo abelii
100477372 Ailuropoda melanoleuca
100516224 Sus scrofa
116236 Homo sapiens
528755 Bos taurus
67477 Mus musculus
303343 Rattus norvegicus
100719781 Cavia porcellus
101121787 Ovis aries

Protein level used designations for ABHD15

  • abhydrolase domain containing 15
  • abhydrolase domain-containing protein 15
  • alpha/beta hydrolase
  • alpha/beta hydrolase-1
  • lung alpha/beta hydrolase 1
Other products related to ABHD15 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com