ABHD15 (Abhydrolase Domain Containing 15, ABHD15)

Products related to ABHD15 Gene:
75 Products
Type
  • 70
  • 5
Species
  • 28
  • 26
  • 21
Application
  • 36
  • 25
  • 16
  • 12
Fusion tag
  • 28
  • 13
  • 8
  • 7
  • 6
Vector Backbone
  • 6
  • 6
  • 6
  • 4
  • 4
Vector
  • 31
  • 19
  • 9
  • 8
  • 2
Insert
  • 21
  • 20
  • 13
  • 8
  • 6
Oligo-Type
  • 5
Resistance Gene
  • 28
  • 25
  • 14
  • 3
  • 2
Expression Type
  • 69
  • 43
Selectable Marker
  • 26
  • 20
Promoter
  • 30
  • 20
  • 8
  • 8
  • 7
Format
  • 30
  • 20
  • 18
  • 7
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 15 (ABHD15)
Gene ID:
116236 (Human, ABHD15)
Synonyms:
ABHD15, Abhd15
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3831481
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 15 (ABHD15)
Gene ID:
116236 (Human, ABHD15)
Synonyms:
ABHD15, Abhd15
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3831482
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Abhydrolase Domain Containing 15 (ABHD15)
Gene ID:
116236 (Human, ABHD15)
Synonyms:
ABHD15, Abhd15
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3410170
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Abhydrolase Domain Containing 15 (ABHD15)
NCBI Accession:
NM_198147,NP_937790
Species:
Human
Synonyms:
ABHD15, Abhd15
Insert length:
1407 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5418524
$410.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see

Application:
RNA Interference
Gene:
Abhydrolase Domain Containing 15
Species:
Rat (Rattus)
Synonyms:
1300007F04Rik, RGD1304598
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • RGD1304598 (Rat) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3355391
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Application:
RNA Interference
Gene:
Abhydrolase Domain Containing 15
Species:
Human
Synonyms:
1300007F04Rik, RGD1304598
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • ABHD15 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3311563
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Abhydrolase Domain Containing 15 (ABHD15)
NCBI Accession:
NM_198147
Species:
Human
Synonyms:
ABHD15, Abhd15
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ABHD15
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5128474
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
Supplier: Log in to see

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Abhydrolase Domain Containing 15 (ABHD15)
NCBI Accession:
NM_001107025
Species:
Rat (Rattus)
Synonyms:
ABHD15, Abhd15
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Abhd15
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5128478
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
Supplier: Log in to see

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Abhydrolase Domain Containing 15 (ABHD15)
NCBI Accession:
NM_026185
Species:
Mouse (Murine)
Synonyms:
ABHD15, Abhd15
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Abhd15
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5128476
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
Supplier: Log in to see

Application:
RNA Interference
Gene:
Abhydrolase Domain Containing 15
Species:
Mouse (Murine)
Synonyms:
1300007F04Rik, RGD1304598
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Abhd15 (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3270996
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Cloning
Gene:
Abhydrolase Domain Containing 15 (ABHD15)
NCBI Accession:
NM_026185
Species:
Mouse (Murine)
Synonyms:
ABHD15, Abhd15
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5745680
$475.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Cloning
Gene:
Abhydrolase Domain Containing 15 (ABHD15)
NCBI Accession:
NM_001107025
Species:
Rat (Rattus)
Synonyms:
ABHD15, Abhd15
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5745681
$475.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Application:
RNA Interference
Gene:
Abhydrolase Domain Containing 15
Gene ID:
116236 (Human, ABHD15)
Synonyms:
1300007F04Rik, RGD1304598
Purification:
Oligonucleotide synthesis is monitored base by base through trityl analysis to ensure appropriate coupling efficiency. The oligo is subsequently purified by affinity-solid phase extraction. The annealed RNA duplex is further analyzed by mass spectrometry to verify the exact composition of the duplex. Each lot is compared to the previous lot by mass spectrometry to ensure maximum lot-to-lot consistency.
Components:
This product is provided as two 5 nmol vials (10 nmol), three 5 nmol vials (15 nmol) or 2x three 5 nmol vials (30 nmol) of lyophilized siRNA oligo duplexes. Each vial contains slightly different sequences to ensure full knockout of the gene. Each vial contains slightly different sequences to ensure full knockout of the gene. The duplexes can be transfected individually or pooled together to achieve knockdown of the target gene, which is most commonly assessed by qPCR or western blot. The siRNA oligos are also chemically modified (2'-OMe) for increased stability and enhanced knockdown in vitro and in vivo.
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5793489
$516.85
Plus shipping costs $45.00
Delivery in 16 to 26 Business Days
Supplier: Log in to see

Application:
RNA Interference
Gene:
Abhydrolase Domain Containing 15
Gene ID:
67477 (Mouse (Murine), ABHD15)
Synonyms:
1300007F04Rik, RGD1304598
Purification:
Oligonucleotide synthesis is monitored base by base through trityl analysis to ensure appropriate coupling efficiency. The oligo is subsequently purified by affinity-solid phase extraction. The annealed RNA duplex is further analyzed by mass spectrometry to verify the exact composition of the duplex. Each lot is compared to the previous lot by mass spectrometry to ensure maximum lot-to-lot consistency.
Components:
This product is provided as two 5 nmol vials (10 nmol), three 5 nmol vials (15 nmol) or 2x three 5 nmol vials (30 nmol) of lyophilized siRNA oligo duplexes. Each vial contains slightly different sequences to ensure full knockout of the gene. Each vial contains slightly different sequences to ensure full knockout of the gene. The duplexes can be transfected individually or pooled together to achieve knockdown of the target gene, which is most commonly assessed by qPCR or western blot. The siRNA oligos are also chemically modified (2'-OMe) for increased stability and enhanced knockdown in vitro and in vivo.
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5793488
$516.85
Plus shipping costs $45.00
Delivery in 16 to 26 Business Days
Supplier: Log in to see

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Abhydrolase Domain Containing 15 (ABHD15)
Gene ID:
116236 (Human, ABHD15)
Synonyms:
ABHD15, Abhd15
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter, U6 Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable

Viral particles:
ABIN5048562

Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN5029617
$503.00
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Abhydrolase Domain Containing 15 (ABHD15)
NCBI Accession:
NM_198147
Species:
Human
Synonyms:
ABHD15, Abhd15
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ABHD15
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5243903
$520.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
Supplier: Log in to see

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Abhydrolase Domain Containing 15 (ABHD15)
NCBI Accession:
NM_001107025
Species:
Rat (Rattus)
Synonyms:
ABHD15, Abhd15
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Abhd15
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5243907
$520.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
Supplier: Log in to see

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Abhydrolase Domain Containing 15 (ABHD15)
NCBI Accession:
NM_026185
Species:
Mouse (Murine)
Synonyms:
ABHD15, Abhd15
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Abhd15
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5243905
$520.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression
Gene:
Abhydrolase Domain Containing 15 (ABHD15)
NCBI Accession:
NM_026185
Species:
Mouse (Murine)
Synonyms:
ABHD15, Abhd15
Insert length:
1380 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4403286
$570.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression
Gene:
Abhydrolase Domain Containing 15 (ABHD15)
NCBI Accession:
NM_001107025
Species:
Rat (Rattus)
Synonyms:
ABHD15, Abhd15
Insert length:
1380 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4497745
$570.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to ABHD15

  • abhydrolase domain containing 15 (ABHD15)
  • abhydrolase domain containing 15 (Abhd15)
  • 1300007F04Rik
  • RGD1304598

Gene-IDs for different species

GENE IDSPECIES
468200 Pan troglodytes
491179 Canis lupus familiaris
711493 Macaca mulatta
100025991 Monodelphis domestica
100399419 Callithrix jacchus
100455726 Pongo abelii
100477372 Ailuropoda melanoleuca
100516224 Sus scrofa
116236 Homo sapiens
528755 Bos taurus
67477 Mus musculus
303343 Rattus norvegicus
100719781 Cavia porcellus
101121787 Ovis aries

Protein level used designations for ABHD15

  • abhydrolase domain containing 15
  • abhydrolase domain-containing protein 15
  • alpha/beta hydrolase
  • alpha/beta hydrolase-1
  • lung alpha/beta hydrolase 1
Other products related to ABHD15 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com