ABHD16B (Abhydrolase Domain Containing 16B, ABHD16B)

Products related to ABHD16B Gene:
Type
  • 74
  • 2
Species
  • 26
  • 26
  • 23
  • 1
Application
  • 41
  • 20
  • 20
  • 13
Fusion tag
  • 29
  • 12
  • 8
  • 8
  • 6
Vector Backbone
  • 8
  • 8
  • 6
  • 5
  • 5
Vector
  • 37
  • 16
  • 9
  • 8
  • 3
Insert
  • 21
  • 18
  • 15
  • 10
  • 8
Oligo-Type
  • 2
Resistance Gene
  • 32
  • 22
  • 17
  • 3
  • 2
Expression Type
  • 72
  • 45
Selectable Marker
  • 28
  • 19
Promoter
  • 32
  • 20
  • 10
  • 8
  • 8
Format
  • 26
  • 24
  • 18
  • 8
76 Products

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 16B (ABHD16B)
Gene ID:
241850 (Mouse, ABHD16B)
Synonyms:
ABHD16B, Abhd16b
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4040067
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 16B (ABHD16B)
Gene ID:
514829 (Cow, ABHD16B)
Synonyms:
ABHD16B, Abhd16b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3859045
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 16B (ABHD16B)
Gene ID:
311720 (Rat, ABHD16B)
Synonyms:
ABHD16B, Abhd16b
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4053179
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Abhydrolase Domain Containing 16B (ABHD16B)
Gene ID:
140701 (Human, ABHD16B)
Synonyms:
ABHD16B, Abhd16b
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR223-1
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3417284
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Abhydrolase Domain Containing 16B (ABHD16B)
NCBI Accession:
NM_080622
Species:
Human
Synonyms:
ABHD16B, Abhd16b
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of C20orf135
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5180072
$420.00
300 μL
Plus shipping costs $45.00 and $24.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Abhydrolase Domain Containing 16B (ABHD16B)
NCBI Accession:
NM_183181
Species:
Mouse
Synonyms:
ABHD16B, Abhd16b
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Abhd16b
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5180076
$420.00
300 μL
Plus shipping costs $45.00 and $24.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Abhydrolase Domain Containing 16B (ABHD16B)
NCBI Accession:
NM_080622
Species:
Human
Synonyms:
ABHD16B, Abhd16b
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ABHD16B
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5180074
$420.00
300 μL
Plus shipping costs $45.00 and $24.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Abhydrolase Domain Containing 16B (ABHD16B)
NCBI Accession:
NM_001014052
Species:
Rat
Synonyms:
ABHD16B, Abhd16b
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Abhd16b
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5180078
$420.00
300 μL
Plus shipping costs $45.00 and $24.00 dry ice
Available

Application:
RNA Interference
Gene:
Abhydrolase Domain Containing 16B
Species:
Human
Synonyms:
C20orf135, dJ591C20.1, 1700095H12, RGD1309726
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • ABHD16B (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3312379
$440.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
Abhydrolase Domain Containing 16B
Species:
Mouse
Synonyms:
C20orf135, dJ591C20.1, 1700095H12, RGD1309726
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • BC050777 (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3271392
$440.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Abhydrolase Domain Containing 16B (ABHD16B)
NCBI Accession:
NM_080622,NP_542189
Species:
Human
Synonyms:
ABHD16B, Abhd16b
Insert length:
1410 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5496970
$453.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Abhydrolase Domain Containing 16B (ABHD16B)
Species:
Human
Synonyms:
ABHD16B, Abhd16b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC-GFP
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
GFP tag
Expression:
Stable, Transient

Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5496969
$500.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Abhydrolase Domain Containing 16B (ABHD16B)
Gene ID:
140701 (Human, ABHD16B)
Synonyms:
ABHD16B, Abhd16b
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter, U6 Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable

Viral particles:
ABIN5049542

Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN5030597
$503.00
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Abhydrolase Domain Containing 16B (ABHD16B)
NCBI Accession:
NM_080622
Species:
Human
Synonyms:
ABHD16B, Abhd16b
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of C20orf135
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5295681
$520.00
300 μL
Plus shipping costs $45.00 and $24.00 dry ice
Available

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Abhydrolase Domain Containing 16B (ABHD16B)
NCBI Accession:
NM_080622
Species:
Human
Synonyms:
ABHD16B, Abhd16b
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ABHD16B
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5295675
$520.00
300 μL
Plus shipping costs $45.00 and $24.00 dry ice
Available

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Abhydrolase Domain Containing 16B (ABHD16B)
NCBI Accession:
NM_183181
Species:
Mouse
Synonyms:
ABHD16B, Abhd16b
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Abhd16b
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5295677
$520.00
300 μL
Plus shipping costs $45.00 and $24.00 dry ice
Available

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Abhydrolase Domain Containing 16B (ABHD16B)
NCBI Accession:
NM_001014052
Species:
Rat
Synonyms:
ABHD16B, Abhd16b
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Abhd16b
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5295679
$520.00
300 μL
Plus shipping costs $45.00 and $24.00 dry ice
Available

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 16B (ABHD16B)
NCBI Accession:
NM_001014052
Species:
Rat
Synonyms:
ABHD16B, Abhd16b
Insert length:
1925 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4680022
$570.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 16B (ABHD16B)
NCBI Accession:
NM_001014052
Species:
Rat
Synonyms:
ABHD16B, Abhd16b
Insert length:
1925 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4741279
$570.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Abhydrolase Domain Containing 16B (ABHD16B)
NCBI Accession:
NM_001014052
Species:
Rat
Synonyms:
ABHD16B, Abhd16b
Insert length:
1925 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-N-D-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag,HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4542483
$570.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to ABHD16B

  • abhydrolase domain containing 16B (ABHD16B)
  • abhydrolase domain containing 16B (Abhd16b)
  • 1700095H12
  • C20orf135
  • dJ591C20.1
  • RGD1309726

Gene-IDs for different species

GENE IDSPECIES
140701 Homo sapiens
241850 Mus musculus
311720 Rattus norvegicus

Protein level used designations for ABHD16B

  • abhydrolase domain-containing protein 16B
Other products related to ABHD16B such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com