ABHD16B (Abhydrolase Domain Containing 16B, ABHD16B)

Products related to ABHD16B Gene:
85 Products
  • 80
  • 5
  • 29
  • 28
  • 26
  • 2
  • 43
  • 26
  • 20
  • 16
Fusion tag
  • 35
  • 15
  • 8
  • 8
  • 6
Vector Backbone
  • 8
  • 8
  • 6
  • 5
  • 5
  • 37
  • 21
  • 9
  • 8
  • 4
  • 24
  • 21
  • 15
  • 10
  • 8
  • 5
Resistance Gene
  • 34
  • 25
  • 18
  • 3
  • 2
Expression Type
  • 77
  • 48
Selectable Marker
  • 28
  • 22
  • 35
  • 23
  • 10
  • 8
  • 8
  • 30
  • 26
  • 18
  • 11
Supplier: Log in to see

Abhydrolase Domain Containing 16B (ABHD16B)
Gene ID:
241850 (Mouse (Murine), ABHD16B)
ABHD16B, Abhd16b
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • M13(-21)
Glycerol Stock
-80 °C
Catalog No. ABIN4040068
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression, Cloning
Abhydrolase Domain Containing 16B (ABHD16B)
Gene ID:
311720 (Rat (Rattus), ABHD16B)
ABHD16B, Abhd16b
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4053178
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression, Cloning
Abhydrolase Domain Containing 16B (ABHD16B)
Gene ID:
514829 (Cow (Bovine), ABHD16B)
ABHD16B, Abhd16b
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3859046
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression, Cloning
Abhydrolase Domain Containing 16B (ABHD16B)
Gene ID:
514829 (Cow (Bovine), ABHD16B)
ABHD16B, Abhd16b
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3859045
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Abhydrolase Domain Containing 16B (ABHD16B)
Gene ID:
241850 (Mouse (Murine), ABHD16B)
ABHD16B, Abhd16b
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • M13(-21)
Glycerol Stock
-80 °C
Catalog No. ABIN4040067
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression, Cloning
Abhydrolase Domain Containing 16B (ABHD16B)
Gene ID:
311720 (Rat (Rattus), ABHD16B)
ABHD16B, Abhd16b
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4053179
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression
Abhydrolase Domain Containing 16B (ABHD16B)
Gene ID:
140701 (Human, ABHD16B)
ABHD16B, Abhd16b
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3417284
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression
Abhydrolase Domain Containing 16B (ABHD16B)
NCBI Accession:
ABHD16B, Abhd16b
Insert length:
1410 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5496970
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see

Genome Editing with Engineered Nucleases, Protein Expression
Abhydrolase Domain Containing 16B (ABHD16B)
NCBI Accession:
ABHD16B, Abhd16b
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of C20orf135
Viral Particles
-80 °C
Catalog No. ABIN5180072
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Supplier: Log in to see

Genome Editing with Engineered Nucleases, Protein Expression
Abhydrolase Domain Containing 16B (ABHD16B)
NCBI Accession:
ABHD16B, Abhd16b
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ABHD16B
Viral Particles
-80 °C
Catalog No. ABIN5180074
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Supplier: Log in to see

Genome Editing with Engineered Nucleases, Protein Expression
Abhydrolase Domain Containing 16B (ABHD16B)
NCBI Accession:
Mouse (Murine)
ABHD16B, Abhd16b
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Abhd16b
Viral Particles
-80 °C
Catalog No. ABIN5180076
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Supplier: Log in to see

Genome Editing with Engineered Nucleases, Protein Expression
Abhydrolase Domain Containing 16B (ABHD16B)
NCBI Accession:
Rat (Rattus)
ABHD16B, Abhd16b
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Abhd16b
Viral Particles
-80 °C
Catalog No. ABIN5180078
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Supplier: Log in to see

RNA Interference
Abhydrolase Domain Containing 16B
C20orf135, dJ591C20.1, 1700095H12, RGD1309726
HPLC purified
Available with shipment
  • ABHD16B (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
-20 °C
Catalog No. ABIN3312379
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

RNA Interference
Abhydrolase Domain Containing 16B
Mouse (Murine)
C20orf135, dJ591C20.1, 1700095H12, RGD1309726
HPLC purified
Available with shipment
  • BC050777 (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
-20 °C
Catalog No. ABIN3271392
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Abhydrolase Domain Containing 16B (ABHD16B)
NCBI Accession:
Rat (Rattus)
ABHD16B, Abhd16b
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5770875
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Abhydrolase Domain Containing 16B (ABHD16B)
NCBI Accession:
Mouse (Murine)
ABHD16B, Abhd16b
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5770874
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

RNA Interference
Abhydrolase Domain Containing 16B
Gene ID:
241850 (Mouse (Murine), ABHD16B)
C20orf135, dJ591C20.1, 1700095H12, RGD1309726
Oligonucleotide synthesis is monitored base by base through trityl analysis to ensure appropriate coupling efficiency. The oligo is subsequently purified by affinity-solid phase extraction. The annealed RNA duplex is further analyzed by mass spectrometry to verify the exact composition of the duplex. Each lot is compared to the previous lot by mass spectrometry to ensure maximum lot-to-lot consistency.
This product is provided as two 5 nmol vials (10 nmol), three 5 nmol vials (15 nmol) or 2x three 5 nmol vials (30 nmol) of lyophilized siRNA oligo duplexes. Each vial contains slightly different sequences to ensure full knockout of the gene. Each vial contains slightly different sequences to ensure full knockout of the gene. The duplexes can be transfected individually or pooled together to achieve knockdown of the target gene, which is most commonly assessed by qPCR or western blot. The siRNA oligos are also chemically modified (2'-OMe) for increased stability and enhanced knockdown in vitro and in vivo.
-20 °C
Catalog No. ABIN5804939
Plus shipping costs $45.00
Delivery in 16 to 26 Business Days
Supplier: Log in to see

RNA Interference
Abhydrolase Domain Containing 16B
Gene ID:
311720 (Rat (Rattus), ABHD16B)
C20orf135, dJ591C20.1, 1700095H12, RGD1309726
Oligonucleotide synthesis is monitored base by base through trityl analysis to ensure appropriate coupling efficiency. The oligo is subsequently purified by affinity-solid phase extraction. The annealed RNA duplex is further analyzed by mass spectrometry to verify the exact composition of the duplex. Each lot is compared to the previous lot by mass spectrometry to ensure maximum lot-to-lot consistency.
This product is provided as two 5 nmol vials (10 nmol), three 5 nmol vials (15 nmol) or 2x three 5 nmol vials (30 nmol) of lyophilized siRNA oligo duplexes. Each vial contains slightly different sequences to ensure full knockout of the gene. Each vial contains slightly different sequences to ensure full knockout of the gene. The duplexes can be transfected individually or pooled together to achieve knockdown of the target gene, which is most commonly assessed by qPCR or western blot. The siRNA oligos are also chemically modified (2'-OMe) for increased stability and enhanced knockdown in vitro and in vivo.
-20 °C
Catalog No. ABIN5804938
Plus shipping costs $45.00
Delivery in 16 to 26 Business Days
Supplier: Log in to see

RNA Interference
Abhydrolase Domain Containing 16B
Gene ID:
140701 (Human, ABHD16B)
C20orf135, dJ591C20.1, 1700095H12, RGD1309726
Oligonucleotide synthesis is monitored base by base through trityl analysis to ensure appropriate coupling efficiency. The oligo is subsequently purified by affinity-solid phase extraction. The annealed RNA duplex is further analyzed by mass spectrometry to verify the exact composition of the duplex. Each lot is compared to the previous lot by mass spectrometry to ensure maximum lot-to-lot consistency.
This product is provided as two 5 nmol vials (10 nmol), three 5 nmol vials (15 nmol) or 2x three 5 nmol vials (30 nmol) of lyophilized siRNA oligo duplexes. Each vial contains slightly different sequences to ensure full knockout of the gene. Each vial contains slightly different sequences to ensure full knockout of the gene. The duplexes can be transfected individually or pooled together to achieve knockdown of the target gene, which is most commonly assessed by qPCR or western blot. The siRNA oligos are also chemically modified (2'-OMe) for increased stability and enhanced knockdown in vitro and in vivo.
-20 °C
Catalog No. ABIN5804937
Plus shipping costs $45.00
Delivery in 16 to 26 Business Days
Supplier: Log in to see

Genome Editing with Engineered Nucleases
Abhydrolase Domain Containing 16B (ABHD16B)
Gene ID:
140701 (Human, ABHD16B)
ABHD16B, Abhd16b
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
SFFV Promoter, U6 Promoter
Fusion Tag:
Transient, Stable

Viral particles:

- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Glycerol Stock
-80 °C
Catalog No. ABIN5030597
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days
  • <
  • 1

Synonyms and alternative names related to ABHD16B

  • abhydrolase domain containing 16B (ABHD16B)
  • abhydrolase domain containing 16B (Abhd16b)
  • 1700095H12
  • C20orf135
  • dJ591C20.1
  • RGD1309726

Gene-IDs for different species

140701 Homo sapiens
241850 Mus musculus
311720 Rattus norvegicus

Protein level used designations for ABHD16B

  • abhydrolase domain-containing protein 16B
Other products related to ABHD16B such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com