ABHD17B (Abhydrolase Domain Containing 17B, ABHD17B)

Products related to ABHD17B Gene:
110 Products
  • 104
  • 6
  • 45
  • 28
  • 27
  • 4
  • 2
  • 64
  • 31
  • 23
  • 16
Fusion tag
  • 45
  • 19
  • 13
  • 9
  • 4
Vector Backbone
  • 8
  • 8
  • 7
  • 6
  • 6
  • 40
  • 35
  • 12
  • 9
  • 7
  • 44
  • 27
  • 17
  • 8
  • 6
  • 6
Resistance Gene
  • 39
  • 37
  • 24
  • 4
  • 2
Expression Type
  • 99
  • 47
Selectable Marker
  • 29
  • 22
  • 38
  • 31
  • 18
  • 12
  • 8
  • 42
  • 27
  • 22
  • 19
Supplier: Log in to see

Abhydrolase Domain Containing 17B (ABHD17B)
Gene ID:
437017 (Zebrafish (Danio rerio), ABHD17B)
Abhd17b, ABHD17B, abhd17b, abhd17b.S
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • M13(-21)
Glycerol Stock
-80 °C
Catalog No. ABIN4042062
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Abhydrolase Domain Containing 17B (ABHD17B)
Gene ID:
51104 (Human, ABHD17B)
Abhd17b, ABHD17B, abhd17b, abhd17b.S
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4212548
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression, Cloning
Abhydrolase Domain Containing 17B (ABHD17B)
Gene ID:
309399 (Rat (Rattus), ABHD17B)
Abhd17b, ABHD17B, abhd17b, abhd17b.S
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4052867
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression, Cloning
Abhydrolase Domain Containing 17B (ABHD17B)
Gene ID:
446585 (Xenopus laevis, ABHD17B)
Abhd17b, ABHD17B, abhd17b, abhd17b.S
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3851290
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression, Cloning
Abhydrolase Domain Containing 17B (ABHD17B)
Gene ID:
51104 (Human, ABHD17B)
Abhd17b, ABHD17B, abhd17b, abhd17b.S
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3879243
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression, Cloning
Abhydrolase Domain Containing 17B (ABHD17B)
Gene ID:
448619 (Xenopus tropicalis, ABHD17B)
Abhd17b, ABHD17B, abhd17b, abhd17b.S
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3885549
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression, Cloning
Abhydrolase Domain Containing 17B (ABHD17B)
Gene ID:
447065 (Xenopus laevis, ABHD17B)
Abhd17b, ABHD17B, abhd17b, abhd17b.S
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3884282
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression, Cloning
Abhydrolase Domain Containing 17B (ABHD17B)
Gene ID:
781153 (Cow (Bovine), ABHD17B)
Abhd17b, ABHD17B, abhd17b, abhd17b.S
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3870853
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Abhydrolase Domain Containing 17B (ABHD17B)
Gene ID:
437017 (Zebrafish (Danio rerio), ABHD17B)
Abhd17b, ABHD17B, abhd17b, abhd17b.S
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • M13(-21)
Glycerol Stock
-80 °C
Catalog No. ABIN4042061
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression, Cloning
Abhydrolase Domain Containing 17B (ABHD17B)
Gene ID:
448619 (Xenopus tropicalis, ABHD17B)
Abhd17b, ABHD17B, abhd17b, abhd17b.S
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3885548
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression, Cloning
Abhydrolase Domain Containing 17B (ABHD17B)
Gene ID:
51104 (Human, ABHD17B)
Abhd17b, ABHD17B, abhd17b, abhd17b.S
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3879241
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression, Cloning
Abhydrolase Domain Containing 17B (ABHD17B)
Gene ID:
447065 (Xenopus laevis, ABHD17B)
Abhd17b, ABHD17B, abhd17b, abhd17b.S
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3884283
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression, Cloning
Abhydrolase Domain Containing 17B (ABHD17B)
Gene ID:
781153 (Cow (Bovine), ABHD17B)
Abhd17b, ABHD17B, abhd17b, abhd17b.S
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3870854
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression, Cloning
Abhydrolase Domain Containing 17B (ABHD17B)
Gene ID:
446585 (Xenopus laevis, ABHD17B)
Abhd17b, ABHD17B, abhd17b, abhd17b.S
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3851291
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression, Cloning
Abhydrolase Domain Containing 17B (ABHD17B)
Gene ID:
309399 (Rat (Rattus), ABHD17B)
Abhd17b, ABHD17B, abhd17b, abhd17b.S
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4052866
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Abhydrolase Domain Containing 17B (ABHD17B)
Gene ID:
51104 (Human, ABHD17B)
Abhd17b, ABHD17B, abhd17b, abhd17b.S
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4212549
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression
Abhydrolase Domain Containing 17B (ABHD17B)
Gene ID:
226016 (Mouse (Murine), ABHD17B)
Abhd17b, ABHD17B, abhd17b, abhd17b.S
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3406179
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Abhydrolase Domain Containing 17B (ABHD17B)
NCBI Accession:
Abhd17b, ABHD17B, abhd17b, abhd17b.S
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5751973
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Protein Expression
Abhydrolase Domain Containing 17B (ABHD17B)
NCBI Accession:
Rat (Rattus)
Abhd17b, ABHD17B, abhd17b, abhd17b.S
Insert length:
867 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
Catalog No. ABIN3292289
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Protein Expression
Abhydrolase Domain Containing 17B (ABHD17B)
NCBI Accession:
Abhd17b, ABHD17B, abhd17b, abhd17b.S
Insert length:
867 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5439036
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
  • <
  • 1

Synonyms and alternative names related to ABHD17B

  • abhydrolase domain containing 17B (Abhd17b)
  • abhydrolase domain containing 17B (ABHD17B)
  • abhydrolase domain containing 17B (abhd17b)
  • abhydrolase domain containing 17B S homeolog (abhd17b.S)
  • 5730446C15Rik
  • abhd17b
  • Abhydrolase domain-containing protein 17B
  • C9orf77
  • Cgi67
  • Cgi67l
  • Fam108b
  • Fam108b1
  • FAM108B1
  • fam108b1
  • RGD1305246
  • RP11-409O11.2
  • zgc:100937

Gene-IDs for different species

226016 Mus musculus
309399 Rattus norvegicus
427252 Gallus gallus
51104 Homo sapiens
437017 Danio rerio
781153 Bos taurus
446585 Xenopus laevis

Protein level used designations for ABHD17B

  • Cgi67 serine protease
  • abhydrolase domain-containing protein FAM108B1
  • alpha/beta hydrolase domain-containing protein 17B
  • family with sequence similarity 108, member B
  • family with sequence similarity 108, member B1
  • Alpha/beta hydrolase domain-containing protein 17B
  • abhydrolase domain containing 17B S homeolog
Other products related to ABHD17B such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com