ABHD17B (Abhydrolase Domain Containing 17B, ABHD17B)

Products related to ABHD17B Gene:
110 Products
Type
  • 104
  • 6
Species
  • 45
  • 28
  • 27
  • 4
  • 2
Application
  • 64
  • 31
  • 23
  • 16
Fusion tag
  • 45
  • 19
  • 13
  • 9
  • 4
Vector Backbone
  • 8
  • 8
  • 7
  • 6
  • 6
Vector
  • 40
  • 35
  • 12
  • 9
  • 7
Insert
  • 44
  • 27
  • 17
  • 8
  • 6
Oligo-Type
  • 6
Resistance Gene
  • 39
  • 37
  • 24
  • 4
  • 2
Expression Type
  • 99
  • 47
Selectable Marker
  • 29
  • 22
Promoter
  • 38
  • 31
  • 18
  • 12
  • 8
Format
  • 42
  • 27
  • 22
  • 19
Supplier: Log in to see

Full length Danio rerio family with sequence similarity 108, member B1 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 17B (ABHD17B)
Gene ID:
437017 (Zebrafish (Danio rerio), ABHD17B)
Synonyms:
Abhd17b, ABHD17B, abhd17b, abhd17b.S
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4042062
$99.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Homo sapiens family with sequence similarity 108, member B1 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 17B (ABHD17B)
Gene ID:
51104 (Human, ABHD17B)
Synonyms:
Abhd17b, ABHD17B, abhd17b, abhd17b.S
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4212548
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Rattus norvegicus family with sequence similarity 108, member B1 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 17B (ABHD17B)
Gene ID:
309399 (Rat (Rattus), ABHD17B)
Synonyms:
Abhd17b, ABHD17B, abhd17b, abhd17b.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4052867
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Xenopus laevis family with sequence similarity 108, member B1 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 17B (ABHD17B)
Gene ID:
446585 (Xenopus laevis, ABHD17B)
Synonyms:
Abhd17b, ABHD17B, abhd17b, abhd17b.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3851290
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Homo sapiens family with sequence similarity 108, member B1 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 17B (ABHD17B)
Gene ID:
51104 (Human, ABHD17B)
Synonyms:
Abhd17b, ABHD17B, abhd17b, abhd17b.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3879243
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Xenopus tropicalis family with sequence similarity 108, member B1 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 17B (ABHD17B)
Gene ID:
448619 (Xenopus tropicalis, ABHD17B)
Synonyms:
Abhd17b, ABHD17B, abhd17b, abhd17b.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3885549
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Xenopus laevis abhydrolase domain-containing protein FAM108B1 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 17B (ABHD17B)
Gene ID:
447065 (Xenopus laevis, ABHD17B)
Synonyms:
Abhd17b, ABHD17B, abhd17b, abhd17b.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3884282
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Bos taurus family with sequence similarity 108, member B1 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 17B (ABHD17B)
Gene ID:
781153 (Cow (Bovine), ABHD17B)
Synonyms:
Abhd17b, ABHD17B, abhd17b, abhd17b.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3870853
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Danio rerio family with sequence similarity 108, member B1 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 17B (ABHD17B)
Gene ID:
437017 (Zebrafish (Danio rerio), ABHD17B)
Synonyms:
Abhd17b, ABHD17B, abhd17b, abhd17b.S
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4042061
$139.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens family with sequence similarity 108, member B1 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 17B (ABHD17B)
Gene ID:
51104 (Human, ABHD17B)
Synonyms:
Abhd17b, ABHD17B, abhd17b, abhd17b.S
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4212549
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Rattus norvegicus family with sequence similarity 108, member B1 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 17B (ABHD17B)
Gene ID:
309399 (Rat (Rattus), ABHD17B)
Synonyms:
Abhd17b, ABHD17B, abhd17b, abhd17b.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4052866
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Xenopus laevis family with sequence similarity 108, member B1 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 17B (ABHD17B)
Gene ID:
446585 (Xenopus laevis, ABHD17B)
Synonyms:
Abhd17b, ABHD17B, abhd17b, abhd17b.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3851291
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens family with sequence similarity 108, member B1 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 17B (ABHD17B)
Gene ID:
51104 (Human, ABHD17B)
Synonyms:
Abhd17b, ABHD17B, abhd17b, abhd17b.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3879241
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Xenopus tropicalis family with sequence similarity 108, member B1 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 17B (ABHD17B)
Gene ID:
448619 (Xenopus tropicalis, ABHD17B)
Synonyms:
Abhd17b, ABHD17B, abhd17b, abhd17b.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3885548
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Xenopus laevis abhydrolase domain-containing protein FAM108B1 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 17B (ABHD17B)
Gene ID:
447065 (Xenopus laevis, ABHD17B)
Synonyms:
Abhd17b, ABHD17B, abhd17b, abhd17b.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3884283
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Bos taurus family with sequence similarity 108, member B1 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 17B (ABHD17B)
Gene ID:
781153 (Cow (Bovine), ABHD17B)
Synonyms:
Abhd17b, ABHD17B, abhd17b, abhd17b.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3870854
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

The family with sequence similarity 108, member B ORF clone is provided in a Gateway adapted entry vector for fast and convenient transfer to any compatible expression vector.

Type:
ORF
Application:
Protein Expression
Gene:
Abhydrolase Domain Containing 17B (ABHD17B)
Gene ID:
226016 (Mouse (Murine), ABHD17B)
Synonyms:
Abhd17b, ABHD17B, abhd17b, abhd17b.S
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR223-1
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3406179
$300.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

ORF Cloning-Vector holds the gene between an AflII and EcoRV cut site.

Type:
ORF
Application:
Cloning
Gene:
Abhydrolase Domain Containing 17B (ABHD17B)
NCBI Accession:
NM_016014
Species:
Human
Synonyms:
Abhd17b, ABHD17B, abhd17b, abhd17b.S
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5751973
$375.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Rat Fam108b1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Abhydrolase Domain Containing 17B (ABHD17B)
NCBI Accession:
NM_001014028,NP_001014050
Species:
Rat (Rattus)
Synonyms:
Abhd17b, ABHD17B, abhd17b, abhd17b.S
Insert length:
867 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3292289
$410.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Mammalian Vector with ORF clone of Human family with sequence similarity 108, member B1 (FAM108B1) transcript variant 2

Type:
ORF
Application:
Protein Expression
Gene:
Abhydrolase Domain Containing 17B (ABHD17B)
NCBI Accession:
NM_001025780,NP_001020951
Species:
Human
Synonyms:
Abhd17b, ABHD17B, abhd17b, abhd17b.S
Insert length:
867 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5439036
$410.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
  • <
  • 1

Synonyms and alternative names related to ABHD17B

  • abhydrolase domain containing 17B (Abhd17b)
  • abhydrolase domain containing 17B (ABHD17B)
  • abhydrolase domain containing 17B (abhd17b)
  • abhydrolase domain containing 17B S homeolog (abhd17b.S)
  • 5730446C15Rik
  • abhd17b
  • Abhydrolase domain-containing protein 17B
  • C9orf77
  • Cgi67
  • Cgi67l
  • Fam108b
  • Fam108b1
  • FAM108B1
  • fam108b1
  • RGD1305246
  • RP11-409O11.2
  • zgc:100937

Gene-IDs for different species

GENE IDSPECIES
226016 Mus musculus
309399 Rattus norvegicus
427252 Gallus gallus
51104 Homo sapiens
437017 Danio rerio
781153 Bos taurus
446585 Xenopus laevis

Protein level used designations for ABHD17B

  • Cgi67 serine protease
  • abhydrolase domain-containing protein FAM108B1
  • alpha/beta hydrolase domain-containing protein 17B
  • family with sequence similarity 108, member B
  • family with sequence similarity 108, member B1
  • Alpha/beta hydrolase domain-containing protein 17B
  • abhydrolase domain containing 17B S homeolog
Other products related to ABHD17B such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com