ABHD17B (Abhydrolase Domain Containing 17B, ABHD17B)

Products related to ABHD17B Gene:
Type
  • 94
  • 3
Species
  • 41
  • 25
  • 25
  • 2
  • 2
Application
  • 58
  • 24
  • 17
  • 16
Fusion tag
  • 35
  • 16
  • 13
  • 9
  • 4
Vector Backbone
  • 8
  • 8
  • 7
  • 6
  • 6
Vector
  • 35
  • 31
  • 12
  • 9
  • 6
Insert
  • 37
  • 27
  • 14
  • 8
  • 6
Oligo-Type
  • 3
Resistance Gene
  • 34
  • 32
  • 24
  • 4
  • 2
Expression Type
  • 90
  • 44
Selectable Marker
  • 26
  • 22
Promoter
  • 35
  • 28
  • 12
  • 12
  • 8
Format
  • 36
  • 27
  • 22
  • 12
97 Products

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 17B (ABHD17B)
Gene ID:
437017 (Zebrafish (Danio rerio), ABHD17B)
Synonyms:
Abhd17b, ABHD17B, abhd17b, abhd17b.S
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4042062
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 17B (ABHD17B)
Gene ID:
437017 (Zebrafish (Danio rerio), ABHD17B)
Synonyms:
Abhd17b, ABHD17B, abhd17b, abhd17b.S
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4042061
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 17B (ABHD17B)
Gene ID:
51104 (Human, ABHD17B)
Synonyms:
Abhd17b, ABHD17B, abhd17b, abhd17b.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3879241
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 17B (ABHD17B)
Gene ID:
448619 (Xenopus tropicalis, ABHD17B)
Synonyms:
Abhd17b, ABHD17B, abhd17b, abhd17b.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3885548
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 17B (ABHD17B)
Gene ID:
447065 (Xenopus laevis, ABHD17B)
Synonyms:
Abhd17b, ABHD17B, abhd17b, abhd17b.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3884283
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 17B (ABHD17B)
Gene ID:
446585 (Xenopus laevis, ABHD17B)
Synonyms:
Abhd17b, ABHD17B, abhd17b, abhd17b.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3851291
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 17B (ABHD17B)
Gene ID:
51104 (Human, ABHD17B)
Synonyms:
Abhd17b, ABHD17B, abhd17b, abhd17b.S
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4212549
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 17B (ABHD17B)
Gene ID:
781153 (Cow, ABHD17B)
Synonyms:
Abhd17b, ABHD17B, abhd17b, abhd17b.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3870854
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 17B (ABHD17B)
Gene ID:
309399 (Rat, ABHD17B)
Synonyms:
Abhd17b, ABHD17B, abhd17b, abhd17b.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4052866
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Abhydrolase Domain Containing 17B (ABHD17B)
Gene ID:
226016 (Mouse, ABHD17B)
Synonyms:
Abhd17b, ABHD17B, abhd17b, abhd17b.S
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR223-1
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3406179
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Abhydrolase Domain Containing 17B (ABHD17B)
NCBI Accession:
NM_016014
Species:
Human
Synonyms:
Abhd17b, ABHD17B, abhd17b, abhd17b.S
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of FAM108B1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5140910
$420.00
300 μL
Plus shipping costs $45.00 and $24.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Abhydrolase Domain Containing 17B (ABHD17B)
NCBI Accession:
NM_001014028
Species:
Rat
Synonyms:
Abhd17b, ABHD17B, abhd17b, abhd17b.S
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Fam108b1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5140912
$420.00
300 μL
Plus shipping costs $45.00 and $24.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Abhydrolase Domain Containing 17B (ABHD17B)
NCBI Accession:
NM_146096
Species:
Mouse
Synonyms:
Abhd17b, ABHD17B, abhd17b, abhd17b.S
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Fam108b
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5181958
$420.00
300 μL
Plus shipping costs $45.00 and $24.00 dry ice
Available

Type:
cDNA
Application:
Protein Expression
Gene:
Abhydrolase Domain Containing 17B (ABHD17B)
NCBI Accession:
NM_146096,NP_666208
Species:
Mouse
Synonyms:
Abhd17b, ABHD17B, abhd17b, abhd17b.S
Insert length:
867 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3308387
$430.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Abhydrolase Domain Containing 17B (ABHD17B)
NCBI Accession:
NM_001014028,NP_001014050
Species:
Rat
Synonyms:
Abhd17b, ABHD17B, abhd17b, abhd17b.S
Insert length:
867 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5439038
$430.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Abhydrolase Domain Containing 17B (ABHD17B)
NCBI Accession:
NM_001014028,NP_001014050
Species:
Rat
Synonyms:
Abhd17b, ABHD17B, abhd17b, abhd17b.S
Insert length:
867 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3292289
$430.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Abhydrolase Domain Containing 17B (ABHD17B)
NCBI Accession:
NM_016014,NP_057098
Species:
Human
Synonyms:
Abhd17b, ABHD17B, abhd17b, abhd17b.S
Insert length:
882 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5439037
$433.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Abhydrolase Domain Containing 17B (ABHD17B)
NCBI Accession:
NM_001025780,NP_001020951
Species:
Human
Synonyms:
Abhd17b, ABHD17B, abhd17b, abhd17b.S
Insert length:
867 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5439036
$433.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Application:
RNA Interference
Gene:
Abhydrolase Domain Containing 17B
Species:
Mouse
Synonyms:
5730446C15Rik, Cgi67, Fam108b, Fam108b1, Cgi67l, RGD1305246, FAM108B1, C9orf77, RP11-409O11.2, fam108b1, zgc:100937, Abhydrolase domain-containing protein 17B, abhd17b
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Fam108b (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3282234
$440.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
Abhydrolase Domain Containing 17B
Species:
Human
Synonyms:
5730446C15Rik, Cgi67, Fam108b, Fam108b1, Cgi67l, RGD1305246, FAM108B1, C9orf77, RP11-409O11.2, fam108b1, zgc:100937, Abhydrolase domain-containing protein 17B, abhd17b
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • ABHD17B (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3285574
$440.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
  • <
  • 1

Synonyms and alternative names related to ABHD17B

  • abhydrolase domain containing 17B (Abhd17b)
  • abhydrolase domain containing 17B (ABHD17B)
  • abhydrolase domain containing 17B (abhd17b)
  • abhydrolase domain containing 17B S homeolog (abhd17b.S)
  • 5730446C15Rik
  • abhd17b
  • Abhydrolase domain-containing protein 17B
  • C9orf77
  • Cgi67
  • Cgi67l
  • Fam108b
  • Fam108b1
  • FAM108B1
  • fam108b1
  • RGD1305246
  • RP11-409O11.2
  • zgc:100937

Gene-IDs for different species

GENE IDSPECIES
226016 Mus musculus
309399 Rattus norvegicus
427252 Gallus gallus
51104 Homo sapiens
437017 Danio rerio
781153 Bos taurus
446585 Xenopus laevis

Protein level used designations for ABHD17B

  • Cgi67 serine protease
  • abhydrolase domain-containing protein FAM108B1
  • alpha/beta hydrolase domain-containing protein 17B
  • family with sequence similarity 108, member B
  • family with sequence similarity 108, member B1
  • Alpha/beta hydrolase domain-containing protein 17B
  • abhydrolase domain containing 17B S homeolog
Other products related to ABHD17B such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com