ABHD17C (Abhydrolase Domain Containing 17C, ABHD17C)

Products related to ABHD17C Gene:
95 Products
Type
  • 90
  • 5
Species
  • 33
  • 27
  • 26
  • 3
  • 2
Application
  • 54
  • 33
  • 19
  • 16
Fusion tag
  • 43
  • 14
  • 9
  • 9
  • 3
Vector Backbone
  • 6
  • 6
  • 6
  • 5
  • 5
Vector
  • 36
  • 27
  • 12
  • 9
  • 5
Insert
  • 43
  • 17
  • 14
  • 8
  • 6
Oligo-Type
  • 5
Resistance Gene
  • 37
  • 33
  • 16
  • 4
  • 2
Expression Type
  • 87
  • 41
Selectable Marker
  • 23
  • 20
Promoter
  • 30
  • 27
  • 16
  • 12
  • 8
Format
  • 33
  • 27
  • 18
  • 17
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 17C (ABHD17C)
Gene ID:
58489 (Human, ABHD17C)
Synonyms:
Abhd17c, ABHD17C, abhd17c.S, abhd17c, LOC488767
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4213085
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 17C (ABHD17C)
Gene ID:
58489 (Human, ABHD17C)
Synonyms:
Abhd17c, ABHD17C, abhd17c.S, abhd17c, LOC488767
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4046659
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 17C (ABHD17C)
Gene ID:
446755 (Xenopus laevis, ABHD17C)
Synonyms:
Abhd17c, ABHD17C, abhd17c.S, abhd17c, LOC488767
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3851527
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 17C (ABHD17C)
Gene ID:
361601 (Rat (Rattus), ABHD17C)
Synonyms:
Abhd17c, ABHD17C, abhd17c.S, abhd17c, LOC488767
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3880929
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 17C (ABHD17C)
Gene ID:
448170 (Xenopus tropicalis, ABHD17C)
Synonyms:
Abhd17c, ABHD17C, abhd17c.S, abhd17c, LOC488767
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3885112
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 17C (ABHD17C)
Gene ID:
520956 (Cow (Bovine), ABHD17C)
Synonyms:
Abhd17c, ABHD17C, abhd17c.S, abhd17c, LOC488767
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3860436
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 17C (ABHD17C)
Gene ID:
70178 (Mouse (Murine), ABHD17C)
Synonyms:
Abhd17c, ABHD17C, abhd17c.S, abhd17c, LOC488767
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3823468
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 17C (ABHD17C)
Gene ID:
448170 (Xenopus tropicalis, ABHD17C)
Synonyms:
Abhd17c, ABHD17C, abhd17c.S, abhd17c, LOC488767
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3885111
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 17C (ABHD17C)
Gene ID:
70178 (Mouse (Murine), ABHD17C)
Synonyms:
Abhd17c, ABHD17C, abhd17c.S, abhd17c, LOC488767
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3823467
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 17C (ABHD17C)
Gene ID:
446755 (Xenopus laevis, ABHD17C)
Synonyms:
Abhd17c, ABHD17C, abhd17c.S, abhd17c, LOC488767
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3851526
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 17C (ABHD17C)
Gene ID:
520956 (Cow (Bovine), ABHD17C)
Synonyms:
Abhd17c, ABHD17C, abhd17c.S, abhd17c, LOC488767
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3860434
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 17C (ABHD17C)
Gene ID:
361601 (Rat (Rattus), ABHD17C)
Synonyms:
Abhd17c, ABHD17C, abhd17c.S, abhd17c, LOC488767
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3880930
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 17C (ABHD17C)
Gene ID:
58489 (Human, ABHD17C)
Synonyms:
Abhd17c, ABHD17C, abhd17c.S, abhd17c, LOC488767
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4046660
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 17C (ABHD17C)
Gene ID:
58489 (Human, ABHD17C)
Synonyms:
Abhd17c, ABHD17C, abhd17c.S, abhd17c, LOC488767
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4213086
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Cloning
Gene:
Abhydrolase Domain Containing 17C (ABHD17C)
Gene ID:
58489 (Human, ABHD17C)
Synonyms:
Abhd17c, ABHD17C, abhd17c.S, abhd17c, LOC488767
Insert length:
990 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5326162
$194.53
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Cloning
Gene:
Abhydrolase Domain Containing 17C (ABHD17C)
Species:
Human
Synonyms:
Abhd17c, ABHD17C, abhd17c.S, abhd17c, LOC488767
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5767392
$325.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Abhydrolase Domain Containing 17C (ABHD17C)
NCBI Accession:
NM_021214,NP_067037
Species:
Human
Synonyms:
Abhd17c, ABHD17C, abhd17c.S, abhd17c, LOC488767
Insert length:
990 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5486855
$410.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression
Gene:
Abhydrolase Domain Containing 17C (ABHD17C)
NCBI Accession:
NM_001100736,NP_001094206
Species:
Rat (Rattus)
Synonyms:
Abhd17c, ABHD17C, abhd17c.S, abhd17c, LOC488767
Insert length:
963 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3292290
$410.00
10 μg
Plus shipping costs $45.00
Will be delivered in 31 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Abhydrolase Domain Containing 17C (ABHD17C)
NCBI Accession:
NM_001100736,NP_001094206
Species:
Rat (Rattus)
Synonyms:
Abhd17c, ABHD17C, abhd17c.S, abhd17c, LOC488767
Insert length:
963 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5486856
$410.00
10 μg
Plus shipping costs $45.00
Will be delivered in 31 Business Days
Supplier: Log in to see

Application:
RNA Interference
Gene:
Abhydrolase Domain Containing 17C
Species:
Rat (Rattus)
Synonyms:
2210412D01Rik, AL023007, Fam108c, Fam108c1, FAM108C1, fam108c1, zgc:55468, RGD1308210, ABHD17C
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Fam108c1 (Rat) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3362294
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
  • <
  • 1

Synonyms and alternative names related to ABHD17C

  • abhydrolase domain containing 17C (Abhd17c)
  • abhydrolase domain containing 17C (ABHD17C)
  • abhydrolase domain containing 17C S homeolog (abhd17c.S)
  • abhydrolase domain containing 17C (abhd17c)
  • protein ABHD17C (LOC488767)
  • 2210412D01Rik
  • ABHD17C
  • AL023007
  • Fam108c
  • Fam108c1
  • FAM108C1
  • fam108c1
  • RGD1308210
  • zgc:55468

Gene-IDs for different species

GENE IDSPECIES
70178 Mus musculus
415479 Gallus gallus
58489 Homo sapiens
520956 Bos taurus
446755 Xenopus laevis
393126 Danio rerio
361601 Rattus norvegicus
488767 Canis lupus familiaris

Protein level used designations for ABHD17C

  • abhydrolase domain-containing protein FAM108C1
  • alpha/beta hydrolase domain-containing protein 17C
  • family with sequence similarity 108, member C
  • family with sequence similarity 108, member C1
  • protein ABHD17C
  • abhydrolase domain containing 17C
Other products related to ABHD17C such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com