ABHD17C (Abhydrolase Domain Containing 17C, ABHD17C)

Products related to ABHD17C Gene:
95 Products
Type
  • 90
  • 5
Species
  • 33
  • 27
  • 26
  • 3
  • 2
Application
  • 54
  • 33
  • 19
  • 16
Fusion tag
  • 43
  • 14
  • 9
  • 9
  • 3
Vector Backbone
  • 6
  • 6
  • 6
  • 5
  • 5
Vector
  • 36
  • 27
  • 12
  • 9
  • 5
Insert
  • 43
  • 17
  • 14
  • 8
  • 6
Oligo-Type
  • 5
Resistance Gene
  • 37
  • 33
  • 16
  • 4
  • 2
Expression Type
  • 87
  • 41
Selectable Marker
  • 23
  • 20
Promoter
  • 30
  • 27
  • 16
  • 12
  • 8
Format
  • 33
  • 27
  • 18
  • 17
Supplier: Log in to see

Full length Homo sapiens family with sequence similarity 108, member C1 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 17C (ABHD17C)
Gene ID:
58489 (Human, ABHD17C)
Synonyms:
Abhd17c, ABHD17C, abhd17c.S, abhd17c, LOC488767
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4213085
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Mus musculus family with sequence similarity 108, member C cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 17C (ABHD17C)
Gene ID:
70178 (Mouse (Murine), ABHD17C)
Synonyms:
Abhd17c, ABHD17C, abhd17c.S, abhd17c, LOC488767
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3823468
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Homo sapiens family with sequence similarity 108, member C1 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 17C (ABHD17C)
Gene ID:
58489 (Human, ABHD17C)
Synonyms:
Abhd17c, ABHD17C, abhd17c.S, abhd17c, LOC488767
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4046659
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Xenopus laevis family with sequence similarity 108, member C1 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 17C (ABHD17C)
Gene ID:
446755 (Xenopus laevis, ABHD17C)
Synonyms:
Abhd17c, ABHD17C, abhd17c.S, abhd17c, LOC488767
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3851527
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Rattus norvegicus family with sequence similarity 108, member C1 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 17C (ABHD17C)
Gene ID:
361601 (Rat (Rattus), ABHD17C)
Synonyms:
Abhd17c, ABHD17C, abhd17c.S, abhd17c, LOC488767
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3880929
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Xenopus tropicalis family with sequence similarity 108, member C1 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 17C (ABHD17C)
Gene ID:
448170 (Xenopus tropicalis, ABHD17C)
Synonyms:
Abhd17c, ABHD17C, abhd17c.S, abhd17c, LOC488767
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3885112
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Bos taurus family with sequence similarity 108, member C1 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 17C (ABHD17C)
Gene ID:
520956 (Cow (Bovine), ABHD17C)
Synonyms:
Abhd17c, ABHD17C, abhd17c.S, abhd17c, LOC488767
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3860436
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens family with sequence similarity 108, member C1 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 17C (ABHD17C)
Gene ID:
58489 (Human, ABHD17C)
Synonyms:
Abhd17c, ABHD17C, abhd17c.S, abhd17c, LOC488767
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4213086
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Mus musculus family with sequence similarity 108, member C cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 17C (ABHD17C)
Gene ID:
70178 (Mouse (Murine), ABHD17C)
Synonyms:
Abhd17c, ABHD17C, abhd17c.S, abhd17c, LOC488767
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3823467
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens family with sequence similarity 108, member C1 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 17C (ABHD17C)
Gene ID:
58489 (Human, ABHD17C)
Synonyms:
Abhd17c, ABHD17C, abhd17c.S, abhd17c, LOC488767
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4046660
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Xenopus laevis family with sequence similarity 108, member C1 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 17C (ABHD17C)
Gene ID:
446755 (Xenopus laevis, ABHD17C)
Synonyms:
Abhd17c, ABHD17C, abhd17c.S, abhd17c, LOC488767
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3851526
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Rattus norvegicus family with sequence similarity 108, member C1 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 17C (ABHD17C)
Gene ID:
361601 (Rat (Rattus), ABHD17C)
Synonyms:
Abhd17c, ABHD17C, abhd17c.S, abhd17c, LOC488767
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3880930
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Xenopus tropicalis family with sequence similarity 108, member C1 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 17C (ABHD17C)
Gene ID:
448170 (Xenopus tropicalis, ABHD17C)
Synonyms:
Abhd17c, ABHD17C, abhd17c.S, abhd17c, LOC488767
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3885111
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Bos taurus family with sequence similarity 108, member C1 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 17C (ABHD17C)
Gene ID:
520956 (Cow (Bovine), ABHD17C)
Synonyms:
Abhd17c, ABHD17C, abhd17c.S, abhd17c, LOC488767
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3860434
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Entry clone of human cDNA (ORF) without STOP codon in Gateway pDONR223 Vector.

Type:
ORF
Application:
Cloning
Gene:
Abhydrolase Domain Containing 17C (ABHD17C)
Gene ID:
58489 (Human, ABHD17C)
Synonyms:
Abhd17c, ABHD17C, abhd17c.S, abhd17c, LOC488767
Insert length:
990 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5326162
$194.53
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
Supplier: Log in to see

ORF Cloning-Vector holds the gene between an AflII and EcoRV cut site.

Type:
ORF
Application:
Cloning
Gene:
Abhydrolase Domain Containing 17C (ABHD17C)
Species:
Human
Synonyms:
Abhd17c, ABHD17C, abhd17c.S, abhd17c, LOC488767
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5767392
$325.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Mammalian Vector with ORF clone of Human family with sequence similarity 108, member C1 (FAM108C1)

Type:
ORF
Application:
Protein Expression
Gene:
Abhydrolase Domain Containing 17C (ABHD17C)
NCBI Accession:
NM_021214,NP_067037
Species:
Human
Synonyms:
Abhd17c, ABHD17C, abhd17c.S, abhd17c, LOC488767
Insert length:
990 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5486855
$410.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Rat Fam108c1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Abhydrolase Domain Containing 17C (ABHD17C)
NCBI Accession:
NM_001100736,NP_001094206
Species:
Rat (Rattus)
Synonyms:
Abhd17c, ABHD17C, abhd17c.S, abhd17c, LOC488767
Insert length:
963 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3292290
$410.00
10 μg
Plus shipping costs $45.00
Will be delivered in 31 Business Days
Supplier: Log in to see

Mammalian Vector with ORF clone of Rat family with sequence similarity 108, member C1 (Fam108c1)

Type:
ORF
Application:
Protein Expression
Gene:
Abhydrolase Domain Containing 17C (ABHD17C)
NCBI Accession:
NM_001100736,NP_001094206
Species:
Rat (Rattus)
Synonyms:
Abhd17c, ABHD17C, abhd17c.S, abhd17c, LOC488767
Insert length:
963 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5486856
$410.00
10 μg
Plus shipping costs $45.00
Will be delivered in 31 Business Days
Supplier: Log in to see

Individual gRNA against Fam108c1 in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Abhydrolase Domain Containing 17C (ABHD17C)
NCBI Accession:
NM_001100736
Species:
Rat (Rattus)
Synonyms:
Abhd17c, ABHD17C, abhd17c.S, abhd17c, LOC488767
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Fam108c1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5171770
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
  • <
  • 1

Synonyms and alternative names related to ABHD17C

  • abhydrolase domain containing 17C (Abhd17c)
  • abhydrolase domain containing 17C (ABHD17C)
  • abhydrolase domain containing 17C S homeolog (abhd17c.S)
  • abhydrolase domain containing 17C (abhd17c)
  • protein ABHD17C (LOC488767)
  • 2210412D01Rik
  • ABHD17C
  • AL023007
  • Fam108c
  • Fam108c1
  • FAM108C1
  • fam108c1
  • RGD1308210
  • zgc:55468

Gene-IDs for different species

GENE IDSPECIES
70178 Mus musculus
415479 Gallus gallus
58489 Homo sapiens
520956 Bos taurus
446755 Xenopus laevis
393126 Danio rerio
361601 Rattus norvegicus
488767 Canis lupus familiaris

Protein level used designations for ABHD17C

  • abhydrolase domain-containing protein FAM108C1
  • alpha/beta hydrolase domain-containing protein 17C
  • family with sequence similarity 108, member C
  • family with sequence similarity 108, member C1
  • protein ABHD17C
  • abhydrolase domain containing 17C
Other products related to ABHD17C such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com