ABHD17C (Abhydrolase Domain Containing 17C, ABHD17C)

Products related to ABHD17C Gene:
  • 81
  • 3
  • 29
  • 25
  • 24
  • 3
  • 1
  • 48
  • 26
  • 16
  • 15
Fusion tag
  • 34
  • 12
  • 9
  • 9
  • 3
Vector Backbone
  • 6
  • 6
  • 5
  • 5
  • 4
  • 28
  • 27
  • 12
  • 9
  • 4
  • 36
  • 17
  • 12
  • 8
  • 6
  • 3
Resistance Gene
  • 31
  • 30
  • 16
  • 4
  • 2
Expression Type
  • 79
  • 39
Selectable Marker
  • 21
  • 20
  • 28
  • 25
  • 12
  • 10
  • 8
  • 29
  • 27
  • 17
  • 11
84 Products

Protein Expression, Cloning
Abhydrolase Domain Containing 17C (ABHD17C)
Gene ID:
448170 (Xenopus tropicalis, ABHD17C)
Abhd17c, ABHD17C, abhd17c.S, abhd17c, LOC488767
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3885111
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Abhydrolase Domain Containing 17C (ABHD17C)
Gene ID:
446755 (Xenopus laevis, ABHD17C)
Abhd17c, ABHD17C, abhd17c.S, abhd17c, LOC488767
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3851526
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Abhydrolase Domain Containing 17C (ABHD17C)
Gene ID:
58489 (Human, ABHD17C)
Abhd17c, ABHD17C, abhd17c.S, abhd17c, LOC488767
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4046660
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Abhydrolase Domain Containing 17C (ABHD17C)
Gene ID:
58489 (Human, ABHD17C)
Abhd17c, ABHD17C, abhd17c.S, abhd17c, LOC488767
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4213086
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Abhydrolase Domain Containing 17C (ABHD17C)
Gene ID:
70178 (Mouse, ABHD17C)
Abhd17c, ABHD17C, abhd17c.S, abhd17c, LOC488767
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3823467
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Abhydrolase Domain Containing 17C (ABHD17C)
Gene ID:
520956 (Cow, ABHD17C)
Abhd17c, ABHD17C, abhd17c.S, abhd17c, LOC488767
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3860434
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Abhydrolase Domain Containing 17C (ABHD17C)
Gene ID:
361601 (Rat, ABHD17C)
Abhd17c, ABHD17C, abhd17c.S, abhd17c, LOC488767
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3880930
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Abhydrolase Domain Containing 17C (ABHD17C)
Gene ID:
58489 (Human, ABHD17C)
Abhd17c, ABHD17C, abhd17c.S, abhd17c, LOC488767
Insert length:
990 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
2 μg of lyophilized gene in pDONR223 vector
-20 °C
Catalog No. ABIN5326162
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Genome Editing with Engineered Nucleases, Protein Expression
Abhydrolase Domain Containing 17C (ABHD17C)
NCBI Accession:
Abhd17c, ABHD17C, abhd17c.S, abhd17c, LOC488767
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of FAM108C1
Viral Particles
-80 °C
Catalog No. ABIN5171768
300 μL
Plus shipping costs $45.00 and $24.00 dry ice

Genome Editing with Engineered Nucleases, Protein Expression
Abhydrolase Domain Containing 17C (ABHD17C)
NCBI Accession:
Abhd17c, ABHD17C, abhd17c.S, abhd17c, LOC488767
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Fam108c
Viral Particles
-80 °C
Catalog No. ABIN5181960
300 μL
Plus shipping costs $45.00 and $24.00 dry ice

Genome Editing with Engineered Nucleases, Protein Expression
Abhydrolase Domain Containing 17C (ABHD17C)
NCBI Accession:
Abhd17c, ABHD17C, abhd17c.S, abhd17c, LOC488767
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Fam108c1
Viral Particles
-80 °C
Catalog No. ABIN5171770
300 μL
Plus shipping costs $45.00 and $24.00 dry ice

Protein Expression
Abhydrolase Domain Containing 17C (ABHD17C)
NCBI Accession:
Abhd17c, ABHD17C, abhd17c.S, abhd17c, LOC488767
Insert length:
963 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5486856
10 μg
Plus shipping costs $45.00
Will be delivered in 31 Business Days

Protein Expression
Abhydrolase Domain Containing 17C (ABHD17C)
NCBI Accession:
Abhd17c, ABHD17C, abhd17c.S, abhd17c, LOC488767
Insert length:
963 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
Catalog No. ABIN3292290
10 μg
Plus shipping costs $45.00
Will be delivered in 31 Business Days

Protein Expression
Abhydrolase Domain Containing 17C (ABHD17C)
NCBI Accession:
Abhd17c, ABHD17C, abhd17c.S, abhd17c, LOC488767
Insert length:
990 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5486855
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

RNA Interference
Abhydrolase Domain Containing 17C
2210412D01Rik, AL023007, Fam108c, Fam108c1, FAM108C1, fam108c1, zgc:55468, RGD1308210, ABHD17C
HPLC purified
Available with shipment
  • 2210412D01Rik (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
-20 °C
Catalog No. ABIN3272348
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

RNA Interference
Abhydrolase Domain Containing 17C
2210412D01Rik, AL023007, Fam108c, Fam108c1, FAM108C1, fam108c1, zgc:55468, RGD1308210, ABHD17C
HPLC purified
Available with shipment
  • ABHD17C (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
-20 °C
Catalog No. ABIN3287779
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

RNA Interference
Abhydrolase Domain Containing 17C
2210412D01Rik, AL023007, Fam108c, Fam108c1, FAM108C1, fam108c1, zgc:55468, RGD1308210, ABHD17C
HPLC purified
Available with shipment
  • Fam108c1 (Rat) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
-20 °C
Catalog No. ABIN3362294
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Abhydrolase Domain Containing 17C (ABHD17C)
Abhd17c, ABHD17C, abhd17c.S, abhd17c, LOC488767
Insert length:
990 bp
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5767392
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Abhydrolase Domain Containing 17C (ABHD17C)
Abhd17c, ABHD17C, abhd17c.S, abhd17c, LOC488767
Insert length:
990 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4701982
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Abhydrolase Domain Containing 17C (ABHD17C)
Abhd17c, ABHD17C, abhd17c.S, abhd17c, LOC488767
Insert length:
990 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4831112
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to ABHD17C

  • abhydrolase domain containing 17C (Abhd17c)
  • abhydrolase domain containing 17C (ABHD17C)
  • abhydrolase domain containing 17C S homeolog (abhd17c.S)
  • abhydrolase domain containing 17C (abhd17c)
  • protein ABHD17C (LOC488767)
  • 2210412D01Rik
  • ABHD17C
  • AL023007
  • Fam108c
  • Fam108c1
  • FAM108C1
  • fam108c1
  • RGD1308210
  • zgc:55468

Gene-IDs for different species

70178 Mus musculus
415479 Gallus gallus
58489 Homo sapiens
520956 Bos taurus
446755 Xenopus laevis
393126 Danio rerio
361601 Rattus norvegicus
488767 Canis lupus familiaris

Protein level used designations for ABHD17C

  • abhydrolase domain-containing protein FAM108C1
  • alpha/beta hydrolase domain-containing protein 17C
  • family with sequence similarity 108, member C
  • family with sequence similarity 108, member C1
  • protein ABHD17C
  • abhydrolase domain containing 17C
Other products related to ABHD17C such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com