ABHD3 (Abhydrolase Domain Containing 3, ABHD3)

Short Description: This gene encodes a protein containing an alpha/beta hydrolase fold, which is a catalytic domain found in a very wide range of enzymes. The function of this protein has not been determined. [provided by RefSeq, Jul 2008].
More information related to gene ABHD3.
Products related to ABHD3 Gene:
129 Products
Type
  • 124
  • 5
Species
  • 52
  • 43
  • 25
  • 3
  • 2
Oligo-Type
  • 3
  • 2
Insert
  • 47
  • 41
  • 20
  • 8
  • 6
Vector
  • 58
  • 35
  • 12
  • 9
  • 7
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
Fusion tag
  • 44
  • 15
  • 13
  • 10
  • 8
Resistance Gene
  • 54
  • 45
  • 20
  • 5
  • 2
Selectable Marker
  • 26
  • 25
  • 24
Promoter
  • 36
  • 32
  • 30
  • 13
  • 8
Expression Type
  • 93
  • 50
  • 24
Application
  • 79
  • 31
  • 23
  • 16
  • 2
Format
  • 62
  • 27
  • 22
  • 18
Supplier: Log in to see

ORF Cloning-Vector holds the gene between an AflII and EcoRV cut site.

Type:
ORF
Application:
Cloning
Gene:
Abhydrolase Domain Containing 3 (ABHD3)
Species:
Human
Synonyms:
ABHD3, Abhd3
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5764872
€39.82
1 μg
Plus shipping costs €45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens abhydrolase domain containing 3.

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 3 (ABHD3)
Species:
Human
Synonyms:
ABHD3, Abhd3
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3545866
€66.37
1 vial
Plus shipping costs €45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Mus musculus abhydrolase domain containing 3.

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 3 (ABHD3)
NCBI Accession:
NM_134130
Species:
Mouse (Murine)
Synonyms:
ABHD3, Abhd3
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3545867
€66.37
1 vial
Plus shipping costs €45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Verified forward and reverse primers for analyzing the quantitative expression of gene

Application:
Quantitative real-time PCR
Gene:
Abhydrolase Domain Containing 3
Species:
Mouse (Murine)
Synonyms:
LABH3, AA675331
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3195679
€69.91
1 vial
Plus shipping costs €45.00
Delivery in 15 to 19 Business Days
Supplier: Log in to see

Verified forward and reverse primers for analyzing the quantitative expression of gene

Application:
Quantitative real-time PCR
Gene:
Abhydrolase Domain Containing 3
Species:
Human
Synonyms:
LABH3, AA675331
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3191180
€69.91
1 vial
Plus shipping costs €45.00
Delivery in 15 to 19 Business Days
Supplier: Log in to see

Full length Danio rerio abhydrolase domain containing 3 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 3 (ABHD3)
Gene ID:
447830 (Zebrafish (Danio rerio), ABHD3)
Synonyms:
ABHD3, Abhd3
Vector type:
Mammalian Expression Vector
Vector backbone:
pME18S-FL3
Resistance Gene:
Ampicillin
Expression:
Transient

Sequencing Primer:
  • Custom (774)
  • Custom (1194)
  • SV40pA-R-genewiz
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4076019
€87.61
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Xenopus laevis abhydrolase domain containing 3 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 3 (ABHD3)
Gene ID:
734476 (Xenopus laevis, ABHD3)
Synonyms:
ABHD3, Abhd3
Vector type:
Cloning Vector
Vector backbone:
pBluescript SK-
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3468872
€97.35
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Mus musculus abhydrolase domain containing 3 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 3 (ABHD3)
Gene ID:
106861 (Mouse (Murine), ABHD3)
Synonyms:
ABHD3, Abhd3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3830280
€97.35
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Xenopus laevis abhydrolase domain containing 3 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 3 (ABHD3)
Gene ID:
380193 (Xenopus laevis, ABHD3)
Synonyms:
ABHD3, Abhd3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3843847
€97.35
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Bos taurus abhydrolase domain containing 3 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 3 (ABHD3)
Gene ID:
539795 (Cow (Bovine), ABHD3)
Synonyms:
ABHD3, Abhd3
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4064887
€97.35
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Xenopus tropicalis abhydrolase domain containing 3 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 3 (ABHD3)
Gene ID:
613088 (Xenopus tropicalis, ABHD3)
Synonyms:
ABHD3, Abhd3
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4066730
€97.35
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Homo sapiens abhydrolase domain containing 3 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 3 (ABHD3)
Gene ID:
171586 (Human, ABHD3)
Synonyms:
ABHD3, Abhd3
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4094821
€97.35
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Danio rerio abhydrolase domain containing 3 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 3 (ABHD3)
Gene ID:
447830 (Zebrafish (Danio rerio), ABHD3)
Synonyms:
ABHD3, Abhd3
Vector type:
Mammalian Expression Vector
Vector backbone:
pME18S-FL3
Resistance Gene:
Ampicillin
Expression:
Transient

Sequencing Primer:
  • Custom (774)
  • Custom (1194)
  • SV40pA-R-genewiz
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4076018
€123.01
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Mus musculus abhydrolase domain containing 3 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 3 (ABHD3)
Gene ID:
106861 (Mouse (Murine), ABHD3)
Synonyms:
ABHD3, Abhd3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3830282
€136.67
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Xenopus laevis abhydrolase domain containing 3 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 3 (ABHD3)
Gene ID:
380193 (Xenopus laevis, ABHD3)
Synonyms:
ABHD3, Abhd3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3843846
€136.67
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Bos taurus abhydrolase domain containing 3 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 3 (ABHD3)
Gene ID:
539795 (Cow (Bovine), ABHD3)
Synonyms:
ABHD3, Abhd3
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4064886
€136.67
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Xenopus tropicalis abhydrolase domain containing 3 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 3 (ABHD3)
Gene ID:
613088 (Xenopus tropicalis, ABHD3)
Synonyms:
ABHD3, Abhd3
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4066729
€136.67
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens abhydrolase domain containing 3 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 3 (ABHD3)
Gene ID:
171586 (Human, ABHD3)
Synonyms:
ABHD3, Abhd3
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4094822
€136.67
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human ABHD3 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Abhydrolase Domain Containing 3 (ABHD3)
NCBI Accession:
NM_138340,NP_612213
Species:
Human
Synonyms:
ABHD3, Abhd3
Insert length:
2000 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948183

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3376872
€168.14
10 μg
Plus shipping costs €45.00
Delivery in 8 to 11 Business Days
Supplier: Log in to see

Full length Clone DNA of Mus musculus abhydrolase domain containing 3 with N terminal His tag.

Type:
ORF
Application:
Protein Expression
Gene:
Abhydrolase Domain Containing 3 (ABHD3)
NCBI Accession:
NM_134130
Species:
Mouse (Murine)
Synonyms:
ABHD3, Abhd3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948173

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3610852
€172.57
1 vial
Plus shipping costs €45.00
Delivery in 20 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to ABHD3

  • abhydrolase domain containing 3 (ABHD3)
  • abhydrolase domain containing 3 (Abhd3)
  • AA675331
  • LABH3

Gene-IDs for different species

GENE IDSPECIES
171586 Homo sapiens
106861 Mus musculus
539795 Bos taurus
291793 Rattus norvegicus
100721630 Cavia porcellus
101122746 Ovis aries

Protein level used designations for ABHD3

  • abhydrolase domain-containing protein 3
  • alpha/beta hydrolase domain containing protein 3
  • lung alpha/beta hydrolase 3
  • mmLABH3
Other products related to ABHD3 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com