ABHD4 (Abhydrolase Domain Containing 4, ABHD4)

Short Description: Lysophospholipase selective for N-acyl phosphatidylethanolamine (NAPE). Contributes to the biosynthesis of N-acyl ethanolamines, including the endocannabinoid anandamide by hydrolyzing the sn-1 and sn-2 acyl chains from N-acyl phosphatidylethanolamine (NAPE) generating glycerophospho-N-acyl ethanolamine (GP-NAE), an intermediate for N-acyl ethanolamine biosynthesis. Hydrolyzes substrates bearing saturated, monounsaturated, polyunsaturated N-acyl chains. Shows no significant activity towards other lysophospholipids, including lysophosphatidylcholine, lysophosphatidylethanolamine and lysophosphatidylserine (By similarity).
More information related to gene ABHD4.
Products related to ABHD4 Gene:
Type
  • 124
  • 4
Species
  • 52
  • 48
  • 25
  • 2
  • 1
Application
  • 80
  • 27
  • 20
  • 16
  • 2
Fusion tag
  • 37
  • 16
  • 13
  • 10
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
Vector
  • 57
  • 35
  • 16
  • 9
  • 4
Insert
  • 47
  • 43
  • 18
  • 8
  • 6
Oligo-Type
  • 2
  • 2
Resistance Gene
  • 64
  • 37
  • 18
  • 5
  • 2
Expression Type
  • 95
  • 50
  • 26
Selectable Marker
  • 27
  • 26
  • 26
Promoter
  • 35
  • 32
  • 28
  • 17
  • 8
Format
  • 60
  • 36
  • 22
  • 10
128 Products

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 4 (ABHD4)
NCBI Accession:
NM_001205181
Species:
Mouse
Synonyms:
ABHD4, abhd4, Abhd4
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3545868
$158.97
1 vial
Plus shipping costs $45.00
Delivery in 17 to 23 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 4 (ABHD4)
NCBI Accession:
NM_022060
Species:
Human
Synonyms:
ABHD4, abhd4, Abhd4
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3545869
$158.97
1 vial
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 4 (ABHD4)
Gene ID:
63874 (Human, ABHD4)
Synonyms:
ABHD4, abhd4, Abhd4
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3818864
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 4 (ABHD4)
Gene ID:
105501 (Mouse, ABHD4)
Synonyms:
ABHD4, abhd4, Abhd4
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3830106
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 4 (ABHD4)
Gene ID:
509896 (Cow, ABHD4)
Synonyms:
ABHD4, abhd4, Abhd4
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3856624
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Application:
Quantitative real-time PCR
Gene:
Abhydrolase Domain Containing 4
Species:
Mouse
Synonyms:
ABH4, abhd5, 1110035H23Rik, AI429574, Abh4, ABHD4, zgc:110267
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3194278
$164.38
1 vial
Plus shipping costs $45.00
Delivery in 12 to 16 Business Days

Application:
Quantitative real-time PCR
Gene:
Abhydrolase Domain Containing 4
Species:
Human
Synonyms:
ABH4, abhd5, 1110035H23Rik, AI429574, Abh4, ABHD4, zgc:110267
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3189347
$164.38
1 vial
Plus shipping costs $45.00
Delivery in 12 to 16 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 4 (ABHD4)
Species:
Human
Synonyms:
ABHD4, abhd4, Abhd4
Insert length:
1029 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4825950
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 4 (ABHD4)
Species:
Human
Synonyms:
ABHD4, abhd4, Abhd4
Insert length:
1029 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4696821
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Abhydrolase Domain Containing 4 (ABHD4)
Gene ID:
63874 (Human, ABHD4)
Synonyms:
ABHD4, abhd4, Abhd4
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3411159
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Abhydrolase Domain Containing 4 (ABHD4)
NCBI Accession:
NM_001205181,NP_001192110
Species:
Mouse
Synonyms:
ABHD4, abhd4, Abhd4
Insert length:
957 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3308391
$340.00
10 μg
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Abhydrolase Domain Containing 4 (ABHD4)
NCBI Accession:
NM_134076
Species:
Mouse
Synonyms:
ABHD4, abhd4, Abhd4
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Abhd4
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5082438
$420.00
300 μL
Plus shipping costs $45.00 and $24.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Abhydrolase Domain Containing 4 (ABHD4)
NCBI Accession:
NM_001108866
Species:
Rat
Synonyms:
ABHD4, abhd4, Abhd4
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Abhd4
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5082440
$420.00
300 μL
Plus shipping costs $45.00 and $24.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Abhydrolase Domain Containing 4 (ABHD4)
NCBI Accession:
NM_022060
Species:
Human
Synonyms:
ABHD4, abhd4, Abhd4
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ABHD4
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5082436
$420.00
300 μL
Plus shipping costs $45.00 and $24.00 dry ice
Available

Type:
cDNA
Application:
Protein Expression
Gene:
Abhydrolase Domain Containing 4 (ABHD4)
NCBI Accession:
NM_134076,NP_598837
Species:
Mouse
Synonyms:
ABHD4, abhd4, Abhd4
Insert length:
1068 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3308390
$430.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Abhydrolase Domain Containing 4 (ABHD4)
NCBI Accession:
NM_001108866,NP_001102336
Species:
Rat
Synonyms:
ABHD4, abhd4, Abhd4
Insert length:
1068 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5334650
$430.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Abhydrolase Domain Containing 4 (ABHD4)
NCBI Accession:
NM_001108866,NP_001102336
Species:
Rat
Synonyms:
ABHD4, abhd4, Abhd4
Insert length:
1068 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3308392
$430.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Abhydrolase Domain Containing 4 (ABHD4)
NCBI Accession:
NM_022060,NP_071343
Species:
Human
Synonyms:
ABHD4, abhd4, Abhd4
Insert length:
1029 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5334649
$433.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Abhydrolase Domain Containing 4 (ABHD4)
NCBI Accession:
NM_022060,NP_071343
Species:
Human
Synonyms:
ABHD4, abhd4, Abhd4
Insert length:
2550 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948183

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3376873
$433.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Application:
RNA Interference
Gene:
Abhydrolase Domain Containing 4
Species:
Mouse
Synonyms:
ABH4, abhd5, 1110035H23Rik, AI429574, Abh4, ABHD4, zgc:110267
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Abhd4 (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3267614
$440.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
  • <
  • 1

Synonyms and alternative names related to ABHD4

  • abhydrolase domain containing 4 (ABHD4)
  • abhydrolase domain containing 4 (abhd4)
  • abhydrolase domain containing 4 (Abhd4)
  • 1110035H23Rik
  • ABH4
  • Abh4
  • ABHD4
  • abhd5
  • AI429574
  • zgc:110267

Gene-IDs for different species

GENE IDSPECIES
63874 Homo sapiens
550041 Xenopus (Silurana) tropicalis
105501 Mus musculus
364380 Rattus norvegicus
452784 Pan troglodytes
509896 Bos taurus
550276 Danio rerio
607421 Canis lupus familiaris
100154266 Sus scrofa
100600556 Nomascus leucogenys
101105755 Ovis aries
100356063 Oryctolagus cuniculus
102180855 Capra hircus
100732867 Cavia porcellus
100056825 Equus caballus

Protein level used designations for ABHD4

  • abhydrolase domain-containing protein 4
  • alpha/beta-hydrolase 4
  • lyso-N-acylphosphatidylethanolamine lipase
  • abhydrolase domain containing 4
  • abhydrolase domain containing 5
  • protein ABHD4
Other products related to ABHD4 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com