ABHD6 (Abhydrolase Domain Containing 6, ABHD6)

Short Description: Has 2-arachidonoylglycerol hydrolase activity (By similarity). May be a regulator of endocannabinoid signaling pathways (By similarity).
More information related to gene ABHD6.
Products related to ABHD6 Gene:
128 Products
Data Quality
  • 2
Type
  • 122
  • 6
Species
  • 42
  • 41
  • 35
  • 4
  • 2
Application
  • 76
  • 33
  • 26
  • 16
  • 1
Fusion tag
  • 46
  • 16
  • 13
  • 10
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
Vector
  • 57
  • 35
  • 12
  • 9
  • 9
Insert
  • 44
  • 41
  • 21
  • 8
  • 6
Oligo-Type
  • 5
  • 1
Resistance Gene
  • 53
  • 44
  • 22
  • 3
  • 2
Expression Type
  • 94
  • 50
  • 22
Selectable Marker
  • 26
  • 25
  • 22
Promoter
  • 36
  • 31
  • 31
  • 12
  • 8
Format
  • 59
  • 27
  • 22
  • 20
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 6 (ABHD6)
Gene ID:
100145783 (Xenopus tropicalis, ABHD6)
Synonyms:
ABHD6, Abhd6, abhd6.S, abhd6, abhd6b, abhd6.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS111
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • Sp6
  • T3
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4033859
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 6 (ABHD6)
Gene ID:
380544 (Xenopus laevis, ABHD6)
Synonyms:
ABHD6, Abhd6, abhd6.S, abhd6, abhd6b, abhd6.L
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4041315
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 6 (ABHD6)
Gene ID:
305795 (Rat (Rattus), ABHD6)
Synonyms:
ABHD6, Abhd6, abhd6.S, abhd6, abhd6b, abhd6.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4052352
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 6 (ABHD6)
Gene ID:
505283 (Cow (Bovine), ABHD6)
Synonyms:
ABHD6, Abhd6, abhd6.S, abhd6, abhd6b, abhd6.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4061268
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 6 (ABHD6)
Gene ID:
57406 (Human, ABHD6)
Synonyms:
ABHD6, Abhd6, abhd6.S, abhd6, abhd6b, abhd6.L
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4092324
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 6 (ABHD6)
Gene ID:
444738 (Xenopus laevis, ABHD6)
Synonyms:
ABHD6, Abhd6, abhd6.S, abhd6, abhd6b, abhd6.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3883829
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 6 (ABHD6)
Gene ID:
66082 (Mouse (Murine), ABHD6)
Synonyms:
ABHD6, Abhd6, abhd6.S, abhd6, abhd6b, abhd6.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3819618
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 6 (ABHD6)
NCBI Accession:
NM_025341
Species:
Mouse (Murine)
Synonyms:
ABHD6, Abhd6, abhd6.S, abhd6, abhd6b, abhd6.L
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3545871
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 6 (ABHD6)
NCBI Accession:
NM_001007680
Species:
Rat (Rattus)
Synonyms:
ABHD6, Abhd6, abhd6.S, abhd6, abhd6b, abhd6.L
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3610918
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Application:
Quantitative real-time PCR
Gene:
Abhydrolase Domain Containing 6
Species:
Rat (Rattus)
Synonyms:
0610041D24Rik, AA673485, AV065425, abhd6-b, abhd6, MGC64518, ABHD6, zgc:162889, abhd6-a
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3197213
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 6 (ABHD6)
Gene ID:
444738 (Xenopus laevis, ABHD6)
Synonyms:
ABHD6, Abhd6, abhd6.S, abhd6, abhd6b, abhd6.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3883830
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 6 (ABHD6)
Gene ID:
100145783 (Xenopus tropicalis, ABHD6)
Synonyms:
ABHD6, Abhd6, abhd6.S, abhd6, abhd6b, abhd6.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS111
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • Sp6
  • T3
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4033860
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 6 (ABHD6)
Gene ID:
66082 (Mouse (Murine), ABHD6)
Synonyms:
ABHD6, Abhd6, abhd6.S, abhd6, abhd6b, abhd6.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3819619
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 6 (ABHD6)
Gene ID:
505283 (Cow (Bovine), ABHD6)
Synonyms:
ABHD6, Abhd6, abhd6.S, abhd6, abhd6b, abhd6.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4061269
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 6 (ABHD6)
Gene ID:
380544 (Xenopus laevis, ABHD6)
Synonyms:
ABHD6, Abhd6, abhd6.S, abhd6, abhd6b, abhd6.L
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4041316
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abhydrolase Domain Containing 6 (ABHD6)
Gene ID:
305795 (Rat (Rattus), ABHD6)
Synonyms:
ABHD6, Abhd6, abhd6.S, abhd6, abhd6b, abhd6.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4052353
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Abhydrolase Domain Containing 6 (ABHD6)
Gene ID:
57406 (Human, ABHD6)
Synonyms:
ABHD6, Abhd6, abhd6.S, abhd6, abhd6b, abhd6.L
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4092325
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Cloning
Gene:
Abhydrolase Domain Containing 6 (ABHD6)
NCBI Accession:
NM_020676
Species:
Human
Synonyms:
ABHD6, Abhd6, abhd6.S, abhd6, abhd6b, abhd6.L
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5720097
$375.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Abhydrolase Domain Containing 6 (ABHD6)
NCBI Accession:
NM_001007680,NP_001007681
Species:
Rat (Rattus)
Synonyms:
ABHD6, Abhd6, abhd6.S, abhd6, abhd6b, abhd6.L
Insert length:
1014 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5334665
$410.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression
Gene:
Abhydrolase Domain Containing 6 (ABHD6)
NCBI Accession:
NM_001007680,NP_001007681
Species:
Rat (Rattus)
Synonyms:
ABHD6, Abhd6, abhd6.S, abhd6, abhd6b, abhd6.L
Insert length:
1014 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3308394
$410.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days
  • <
  • 1

Synonyms and alternative names related to ABHD6

  • abhydrolase domain containing 6 (ABHD6)
  • abhydrolase domain containing 6 (Abhd6)
  • abhydrolase domain containing 6 S homeolog (abhd6.S)
  • abhydrolase domain containing 6 (abhd6)
  • abhydrolase domain containing 6b (abhd6b)
  • abhydrolase domain containing 6 L homeolog (abhd6.L)
  • 0610041D24Rik
  • AA673485
  • abhd6
  • ABHD6
  • abhd6-a
  • abhd6-b
  • AV065425
  • MGC64518
  • zgc:162889

Gene-IDs for different species

GENE IDSPECIES
57406 Homo sapiens
66082 Mus musculus
380544 Xenopus laevis
416009 Gallus gallus
470830 Pan troglodytes
484712 Canis lupus familiaris
702384 Macaca mulatta
100057821 Equus caballus
100145783 Xenopus (Silurana) tropicalis
100399741 Callithrix jacchus
100433718 Pongo abelii
100482314 Ailuropoda melanoleuca
100515411 Sus scrofa
100355792 Oryctolagus cuniculus
100603829 Nomascus leucogenys
305795 Rattus norvegicus
505283 Bos taurus
100732636 Cavia porcellus
558995 Danio rerio
444738 Xenopus laevis

Protein level used designations for ABHD6

  • 2-arachidonoylglycerol hydrolase
  • abhydrolase domain-containing protein 6
  • lipase protein
  • monoacylglycerol lipase ABHD6
  • monoacylglycerol lipase abhd6-B
  • abhydrolase domain-containing protein 6-B
  • abhydrolase domain containing 6
  • monoacylglycerol lipase ABHD6-like
  • Abhydrolase domain-containing protein 6-A
  • abhydrolase domain-containing protein 6-A
  • monoacylglycerol lipase abhd6-A
Other products related to ABHD6 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com