ABHD8 (Abhydrolase Domain Containing 8, ABHD8)

Short Description: This gene is upstream of, and in a head-to-head orientation with the gene for the mitochondrial ribosomal protein L34. The predicted protein contains alpha/beta hydrolase fold and secretory lipase domains. [provided by RefSeq, Jul 2008].
More information related to gene ABHD8.
Products related to ABHD8 Gene:
  • 106
  • 3
  • 40
  • 35
  • 29
  • 2
  • 1
  • 63
  • 28
  • 21
  • 16
Fusion tag
  • 38
  • 13
  • 11
  • 10
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
  • 40
  • 35
  • 12
  • 9
  • 8
  • 39
  • 33
  • 18
  • 8
  • 6
  • 3
Resistance Gene
  • 42
  • 37
  • 23
  • 4
  • 2
Expression Type
  • 86
  • 47
  • 13
  • 1
Selectable Marker
  • 26
  • 22
  • 13
  • 28
  • 28
  • 24
  • 12
  • 8
  • 43
  • 27
  • 22
  • 17
109 Products

Protein Expression, Cloning
Abhydrolase Domain Containing 8 (ABHD8)
Gene ID:
558563 (Zebrafish (Danio rerio), ABHD8)
abhd8.L, ABHD8, abhd8a, abhd8, Abhd8
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4065872
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Abhydrolase Domain Containing 8 (ABHD8)
Gene ID:
558563 (Zebrafish (Danio rerio), ABHD8)
abhd8.L, ABHD8, abhd8a, abhd8, Abhd8
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4065871
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Abhydrolase Domain Containing 8 (ABHD8)
NCBI Accession:
abhd8.L, ABHD8, abhd8a, abhd8, Abhd8
Vector type:
TA-Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Catalog No. ABIN3610932
1 vial
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Protein Expression, Cloning
Abhydrolase Domain Containing 8 (ABHD8)
Gene ID:
447237 (Xenopus laevis, ABHD8)
abhd8.L, ABHD8, abhd8a, abhd8, Abhd8
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3884318
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Abhydrolase Domain Containing 8 (ABHD8)
Gene ID:
79575 (Human, ABHD8)
abhd8.L, ABHD8, abhd8a, abhd8, Abhd8
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3826605
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Abhydrolase Domain Containing 8 (ABHD8)
Gene ID:
100124836 (Xenopus tropicalis, ABHD8)
abhd8.L, ABHD8, abhd8a, abhd8, Abhd8
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4031743
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Abhydrolase Domain Containing 8 (ABHD8)
Gene ID:
79575 (Human, ABHD8)
abhd8.L, ABHD8, abhd8a, abhd8, Abhd8
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4093012
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Abhydrolase Domain Containing 8 (ABHD8)
Gene ID:
79575 (Human, ABHD8)
abhd8.L, ABHD8, abhd8a, abhd8, Abhd8
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4093013
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Abhydrolase Domain Containing 8 (ABHD8)
Gene ID:
768306 (Cow, ABHD8)
abhd8.L, ABHD8, abhd8a, abhd8, Abhd8
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4069229
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Abhydrolase Domain Containing 8 (ABHD8)
Gene ID:
64296 (Mouse, ABHD8)
abhd8.L, ABHD8, abhd8a, abhd8, Abhd8
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3819119
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Abhydrolase Domain Containing 8 (ABHD8)
Gene ID:
306338 (Rat, ABHD8)
abhd8.L, ABHD8, abhd8a, abhd8, Abhd8
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • M13(-21)
Glycerol Stock
-80 °C
Catalog No. ABIN4040386
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Abhydrolase Domain Containing 8 (ABHD8)
Gene ID:
306338 (Rat, ABHD8)
abhd8.L, ABHD8, abhd8a, abhd8, Abhd8
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • M13(-21)
Glycerol Stock
-80 °C
Catalog No. ABIN4040388
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Abhydrolase Domain Containing 8 (ABHD8)
Gene ID:
306338 (Rat, ABHD8)
abhd8.L, ABHD8, abhd8a, abhd8, Abhd8
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • M13(-21)
Glycerol Stock
-80 °C
Catalog No. ABIN4040387
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression
Abhydrolase Domain Containing 8 (ABHD8)
Gene ID:
79575 (Human, ABHD8)
abhd8.L, ABHD8, abhd8a, abhd8, Abhd8
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3410872
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Genome Editing with Engineered Nucleases, Protein Expression
Abhydrolase Domain Containing 8 (ABHD8)
NCBI Accession:
abhd8.L, ABHD8, abhd8a, abhd8, Abhd8
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Abhd8
Viral Particles
-80 °C
Catalog No. ABIN5129554
300 μL
Plus shipping costs $45.00 and $24.00 dry ice

Genome Editing with Engineered Nucleases, Protein Expression
Abhydrolase Domain Containing 8 (ABHD8)
NCBI Accession:
abhd8.L, ABHD8, abhd8a, abhd8, Abhd8
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Abhd8
Viral Particles
-80 °C
Catalog No. ABIN5129556
300 μL
Plus shipping costs $45.00 and $24.00 dry ice

Genome Editing with Engineered Nucleases, Protein Expression
Abhydrolase Domain Containing 8 (ABHD8)
NCBI Accession:
abhd8.L, ABHD8, abhd8a, abhd8, Abhd8
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ABHD8
Viral Particles
-80 °C
Catalog No. ABIN5129552
300 μL
Plus shipping costs $45.00 and $24.00 dry ice

Protein Expression
Abhydrolase Domain Containing 8 (ABHD8)
NCBI Accession:
abhd8.L, ABHD8, abhd8a, abhd8, Abhd8
Insert length:
1320 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5420185
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Protein Expression
Abhydrolase Domain Containing 8 (ABHD8)
NCBI Accession:
abhd8.L, ABHD8, abhd8a, abhd8, Abhd8
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter
Transient, Stable

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
Catalog No. ABIN3319541
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

RNA Interference
Abhydrolase Domain Containing 8
MGC84423, zgc:172283, 0910001L24Rik, AB030191
HPLC purified
Available with shipment
  • Abhd8 (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
-20 °C
Catalog No. ABIN3270504
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
  • <
  • 1

Synonyms and alternative names related to ABHD8

  • abhydrolase domain containing 8 L homeolog (abhd8.L)
  • abhydrolase domain containing 8 (ABHD8)
  • abhydrolase domain containing 8a (abhd8a)
  • abhydrolase domain containing 8 (abhd8)
  • abhydrolase domain containing 8 (Abhd8)
  • 0910001L24Rik
  • AB030191
  • MGC84423
  • zgc:172283

Gene-IDs for different species

447237 Xenopus laevis
748780 Pan troglodytes
100070083 Equus caballus
100090375 Ornithorhynchus anatinus
484840 Canis lupus familiaris
558563 Danio rerio
718980 Macaca mulatta
100124836 Xenopus (Silurana) tropicalis
100592368 Nomascus leucogenys
79575 Homo sapiens
64296 Mus musculus
306338 Rattus norvegicus
768306 Bos taurus
100732178 Cavia porcellus
100857580 Gallus gallus
101115366 Ovis aries

Protein level used designations for ABHD8

  • abhydrolase domain-containing protein 8
  • abhydrolase domain containing 8
Other products related to ABHD8 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com