ABI1 (Abl-Interactor 1, ABI1)

Short Description: This gene encodes a member of the Abelson-interactor family of adaptor proteins. These proteins facilitate signal transduction as components of several multiprotein complexes, and regulate actin polymerization and cytoskeletal remodeling through interactions with Abelson tyrosine kinases. The encoded protein plays a role in macropinocytosis as a component of the WAVE2 complex, and also forms a complex with EPS8 and SOS1 that mediates signal transduction from Ras to Rac. This gene may play a role in the progression of several malignancies including melanoma, colon cancer and breast cancer, and a t(10\;11) chromosomal translocation involving this gene and the MLL gene has been associated with acute myeloid leukemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 14. [provided by RefSeq, Sep 2011].
More information related to gene ABI1.
Products related to ABI1 Gene:
247 Products
Type
  • 240
  • 7
Species
  • 110
  • 83
  • 45
  • 3
  • 2
Application
  • 174
  • 53
  • 27
  • 16
  • 1
Fusion tag
  • 60
  • 51
  • 45
  • 23
  • 14
Vector Backbone
  • 30
  • 30
  • 18
  • 12
  • 12
Vector
  • 107
  • 83
  • 28
  • 13
  • 9
Insert
  • 117
  • 86
  • 21
  • 8
  • 6
Oligo-Type
  • 6
  • 1
Resistance Gene
  • 92
  • 73
  • 68
  • 7
  • 2
Expression Type
  • 221
  • 88
  • 13
Selectable Marker
  • 67
  • 26
  • 13
Promoter
  • 128
  • 37
  • 34
  • 31
  • 8
Format
  • 123
  • 63
  • 40
  • 21
Supplier: Log in to see

Full length Danio rerio abl-interactor 1b cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abl-Interactor 1 (ABI1)
Gene ID:
767738 (Zebrafish (Danio rerio), ABI1)
Synonyms:
ABI1, Abi1, abi1a, abi1.S, abi1, abi1b, Bm1_44660, LOAG_04356
Vector type:
Mammalian Expression Vector
Vector backbone:
pME18S-FL3
Resistance Gene:
Ampicillin
Expression:
Transient

Sequencing Primer:
  • Custom (774)
  • Custom (1194)
  • SV40pA-R-genewiz
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4081183
$99.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Danio rerio abl-interactor 1a cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Abl-Interactor 1 (ABI1)
Gene ID:
393711 (Zebrafish (Danio rerio), ABI1)
Synonyms:
ABI1, Abi1, abi1a, abi1.S, abi1, abi1b, Bm1_44660, LOAG_04356
Vector type:
Cloning Vector
Vector backbone:
pBluescript SK-
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3468585
$99.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Mus musculus abl-interactor 1 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abl-Interactor 1 (ABI1)
Gene ID:
11308 (Mouse (Murine), ABI1)
Synonyms:
ABI1, Abi1, abi1a, abi1.S, abi1, abi1b, Bm1_44660, LOAG_04356
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3807457
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Rattus norvegicus abl-interactor 1 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abl-Interactor 1 (ABI1)
Gene ID:
79249 (Rat (Rattus), ABI1)
Synonyms:
ABI1, Abi1, abi1a, abi1.S, abi1, abi1b, Bm1_44660, LOAG_04356
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4047236
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Homo sapiens abl-interactor 1 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Abl-Interactor 1 (ABI1)
Gene ID:
10006 (Human, ABI1)
Synonyms:
ABI1, Abi1, abi1a, abi1.S, abi1, abi1b, Bm1_44660, LOAG_04356
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4088560
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Mus musculus abl-interactor 1 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Abl-Interactor 1 (ABI1)
Gene ID:
11308 (Mouse (Murine), ABI1)
Synonyms:
ABI1, Abi1, abi1a, abi1.S, abi1, abi1b, Bm1_44660, LOAG_04356
Vector type:
Cloning Vector
Vector backbone:
pYX-Asc
Resistance Gene:
Ampicillin
Promoter:
T3 Promoter

Sequencing Primer:
  • T7
  • T3
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4098376
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Xenopus tropicalis abl-interactor 1 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abl-Interactor 1 (ABI1)
Gene ID:
493216 (Xenopus tropicalis, ABI1)
Synonyms:
ABI1, Abi1, abi1a, abi1.S, abi1, abi1b, Bm1_44660, LOAG_04356
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3885677
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Xenopus laevis abl-interactor 1 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abl-Interactor 1 (ABI1)
Gene ID:
447582 (Xenopus laevis, ABI1)
Synonyms:
ABI1, Abi1, abi1a, abi1.S, abi1, abi1b, Bm1_44660, LOAG_04356
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3884611
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Bos taurus abl-interactor 1 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abl-Interactor 1 (ABI1)
Gene ID:
540815 (Cow (Bovine), ABI1)
Synonyms:
ABI1, Abi1, abi1a, abi1.S, abi1, abi1b, Bm1_44660, LOAG_04356
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4065107
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Clone DNA of Rattus norvegicus abl-interactor 1.

Type:
cDNA
Application:
Cloning
Gene:
Abl-Interactor 1 (ABI1)
NCBI Accession:
NM_024397
Species:
Rat (Rattus)
Synonyms:
ABI1, Abi1, abi1a, abi1.S, abi1, abi1b, Bm1_44660, LOAG_04356
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3545872
$125.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Verified forward and reverse primers for analyzing the quantitative expression of gene

Application:
Quantitative real-time PCR
Gene:
Abl-Interactor 1
Species:
Rat (Rattus)
Synonyms:
ABI-1, ABLBP4, E3B1, NAP1BP, SSH3BP, SSH3BP1, NAP1, Ssh3bp1, E3b1, abi1, wu:fc66g09, wu:fk56a10, zgc:73174, MGC84356, ABI1, abi-1, e3b1, nap1bp, ssh3bp, ssh3bp1, wu:fe48a10, zgc:153534, DKFZp469P1319
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3197433
$129.00
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Danio rerio abl-interactor 1b cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abl-Interactor 1 (ABI1)
Gene ID:
767738 (Zebrafish (Danio rerio), ABI1)
Synonyms:
ABI1, Abi1, abi1a, abi1.S, abi1, abi1b, Bm1_44660, LOAG_04356
Vector type:
Mammalian Expression Vector
Vector backbone:
pME18S-FL3
Resistance Gene:
Ampicillin
Expression:
Transient

Sequencing Primer:
  • Custom (774)
  • Custom (1194)
  • SV40pA-R-genewiz
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4081184
$139.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Mus musculus abl-interactor 1 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abl-Interactor 1 (ABI1)
Gene ID:
11308 (Mouse (Murine), ABI1)
Synonyms:
ABI1, Abi1, abi1a, abi1.S, abi1, abi1b, Bm1_44660, LOAG_04356
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3807456
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Rattus norvegicus abl-interactor 1 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abl-Interactor 1 (ABI1)
Gene ID:
79249 (Rat (Rattus), ABI1)
Synonyms:
ABI1, Abi1, abi1a, abi1.S, abi1, abi1b, Bm1_44660, LOAG_04356
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4047237
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens abl-interactor 1 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Abl-Interactor 1 (ABI1)
Gene ID:
10006 (Human, ABI1)
Synonyms:
ABI1, Abi1, abi1a, abi1.S, abi1, abi1b, Bm1_44660, LOAG_04356
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4088561
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Mus musculus abl-interactor 1 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Abl-Interactor 1 (ABI1)
Gene ID:
11308 (Mouse (Murine), ABI1)
Synonyms:
ABI1, Abi1, abi1a, abi1.S, abi1, abi1b, Bm1_44660, LOAG_04356
Vector type:
Cloning Vector
Vector backbone:
pYX-Asc
Resistance Gene:
Ampicillin
Promoter:
T3 Promoter

Sequencing Primer:
  • T7
  • T3
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4098377
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Xenopus laevis abl-interactor 1 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abl-Interactor 1 (ABI1)
Gene ID:
447582 (Xenopus laevis, ABI1)
Synonyms:
ABI1, Abi1, abi1a, abi1.S, abi1, abi1b, Bm1_44660, LOAG_04356
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3884612
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Xenopus tropicalis abl-interactor 1 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abl-Interactor 1 (ABI1)
Gene ID:
493216 (Xenopus tropicalis, ABI1)
Synonyms:
ABI1, Abi1, abi1a, abi1.S, abi1, abi1b, Bm1_44660, LOAG_04356
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3885676
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Bos taurus abl-interactor 1 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abl-Interactor 1 (ABI1)
Gene ID:
540815 (Cow (Bovine), ABI1)
Synonyms:
ABI1, Abi1, abi1a, abi1.S, abi1, abi1b, Bm1_44660, LOAG_04356
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4065108
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Clone DNA of Rattus norvegicus abl-interactor 1 with N terminal His tag.

Type:
ORF
Application:
Protein Expression
Gene:
Abl-Interactor 1 (ABI1)
NCBI Accession:
NM_024397
Species:
Rat (Rattus)
Synonyms:
ABI1, Abi1, abi1a, abi1.S, abi1, abi1b, Bm1_44660, LOAG_04356
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-N-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948169

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3610942
$245.00
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
  • <
  • 1
  • ...
  • ...

Synonyms and alternative names related to ABI1

  • abl interactor 1 (ABI1)
  • abl-interactor 1 (Abi1)
  • abl-interactor 1a (abi1a)
  • abl interactor 1 S homeolog (abi1.S)
  • abl interactor 1 (abi1)
  • abl-interactor 1b (abi1b)
  • Abl-interactor 1 (Bm1_44660)
  • Abl interactor 1 (abi1)
  • abl-interactor 1 (LOAG_04356)
  • abl interactor 1 (Abi1)
  • ABI-1
  • abi-1
  • abi1
  • ABI1
  • ABLBP4
  • DKFZp469P1319
  • E3b1
  • e3b1
  • E3B1
  • MGC84356
  • NAP1
  • nap1bp
  • NAP1BP
  • SSH3BP
  • ssh3bp
  • Ssh3bp1
  • SSH3BP1
  • ssh3bp1
  • wu:fc66g09
  • wu:fe48a10
  • wu:fk56a10
  • zgc:73174
  • zgc:153534

Gene-IDs for different species

GENE IDSPECIES
10006 Homo sapiens
11308 Mus musculus
79249 Rattus norvegicus
393711 Danio rerio
420489 Gallus gallus
447582 Xenopus laevis
450363 Pan troglodytes
493216 Xenopus (Silurana) tropicalis
540815 Bos taurus
607247 Canis lupus familiaris
707698 Macaca mulatta
767738 Danio rerio
6103816 Brugia malayi
100055377 Equus caballus
100173382 Pongo abelii
100195035 Salmo salar
100408906 Callithrix jacchus
100465106 Ailuropoda melanoleuca
9941758 Loa loa
100598819 Nomascus leucogenys
100720396 Cavia porcellus
100349265 Oryctolagus cuniculus

Protein level used designations for ABI1

  • Abelson interactor 1
  • Abl-interactor protein 1 long
  • abl interactor 1
  • abl-binding protein 4
  • eps8 SH3 domain-binding protein
  • interactor protein AblBP4
  • nap1 binding protein
  • spectrin SH3 domain-binding protein 1
  • abelson interactor 1
  • abi-1
  • ablphilin-1
  • eps8 binding protein
  • eps8-binding protein
  • spectrin SH3 domain binding protein 1
  • eps8 binding protein (e3B1), alternatively spliced
  • abl-interactor 1
  • Abl-interactor 1
  • Abl interactor 1
  • abl interactor 1-like
  • LOW QUALITY PROTEIN: abl interactor 1
Other products related to ABI1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com