ABI2 (Abl-Interactor 2, ABI2)

Short Description: thyroid hormone-responsive protein that is a substrate for the tyrosine kinase activity of cAb1
More information related to gene ABI2.
Products related to ABI2 Gene:
156 Products
Type
  • 150
  • 6
Species
  • 67
  • 53
  • 26
  • 4
  • 2
Application
  • 89
  • 45
  • 25
  • 16
  • 1
Fusion tag
  • 58
  • 17
  • 15
  • 14
  • 8
Vector Backbone
  • 13
  • 6
  • 6
  • 6
  • 6
Vector
  • 65
  • 36
  • 20
  • 15
  • 9
Insert
  • 67
  • 47
  • 20
  • 8
  • 6
Oligo-Type
  • 5
  • 1
Resistance Gene
  • 72
  • 51
  • 20
  • 7
  • 2
Expression Type
  • 122
  • 62
  • 13
Selectable Marker
  • 44
  • 26
  • 13
  • 1
Promoter
  • 46
  • 30
  • 30
  • 20
  • 8
Format
  • 63
  • 45
  • 26
  • 22
Supplier: Log in to see

Type:
ORF
Application:
Cloning
Gene:
Abl-Interactor 2 (ABI2)
Species:
Human
Synonyms:
ABI2, abi2, Abi2
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5748483
$70.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Abl-Interactor 2 (ABI2)
NCBI Accession:
NM_005759,NP_005750
Species:
Human
Synonyms:
ABI2, abi2, Abi2
Insert length:
1428 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5427615
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abl-Interactor 2 (ABI2)
Gene ID:
692331 (Zebrafish (Danio rerio), ABI2)
Synonyms:
ABI2, abi2, Abi2
Vector type:
Mammalian Expression Vector
Vector backbone:
pME18S-FL3
Resistance Gene:
Ampicillin
Expression:
Transient

Sequencing Primer:
  • Custom (774)
  • Custom (1194)
  • SV40pA-R-genewiz
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4080754
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
Abl-Interactor 2 (ABI2)
NCBI Accession:
NM_005759
Gene ID:
10152 (Human, ABI2)
Synonyms:
ABI2, abi2, Abi2
Insert length:
1428 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4941830
$99.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 6 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Abl-Interactor 2 (ABI2)
Gene ID:
548798 (Xenopus tropicalis, ABI2)
Synonyms:
ABI2, abi2, Abi2
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4021733
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Abl-Interactor 2 (ABI2)
Gene ID:
10152 (Human, ABI2)
Synonyms:
ABI2, abi2, Abi2
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4088688
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Abl-Interactor 2 (ABI2)
Gene ID:
329165 (Mouse (Murine), ABI2)
Synonyms:
ABI2, abi2, Abi2
Vector type:
Cloning Vector
Vector backbone:
pYX-Asc
Resistance Gene:
Ampicillin
Promoter:
T3 Promoter

Sequencing Primer:
  • T7
  • T3
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4103352
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Abl-Interactor 2 (ABI2)
Gene ID:
329165 (Mouse (Murine), ABI2)
Synonyms:
ABI2, abi2, Abi2
Vector type:
Cloning Vector
Vector backbone:
pYX-Asc
Resistance Gene:
Ampicillin
Promoter:
T3 Promoter

Sequencing Primer:
  • T7
  • T3
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4103353
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Abl-Interactor 2 (ABI2)
Gene ID:
329165 (Mouse (Murine), ABI2)
Synonyms:
ABI2, abi2, Abi2
Vector type:
Cloning Vector
Vector backbone:
pYX-Asc
Resistance Gene:
Ampicillin
Promoter:
T3 Promoter

Sequencing Primer:
  • T7
  • T3
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4103354
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abl-Interactor 2 (ABI2)
Gene ID:
548798 (Xenopus tropicalis, ABI2)
Synonyms:
ABI2, abi2, Abi2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3864888
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abl-Interactor 2 (ABI2)
Gene ID:
537711 (Cow (Bovine), ABI2)
Synonyms:
ABI2, abi2, Abi2
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4064553
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abl-Interactor 2 (ABI2)
Gene ID:
394360 (Xenopus laevis, ABI2)
Synonyms:
ABI2, abi2, Abi2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3845181
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Application:
Quantitative real-time PCR
Gene:
Abl-Interactor 2
Species:
Human
Synonyms:
ABI-2, ABI2B, AIP-1, AblBP3, SSH3BP2, argBPIA, argBPIB, 8430425M24Rik, AI839867, C130078H13
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3191449
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Abl-Interactor 2 (ABI2)
Species:
Human
Synonyms:
ABI2, abi2, Abi2
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3545873
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abl-Interactor 2 (ABI2)
Gene ID:
692331 (Zebrafish (Danio rerio), ABI2)
Synonyms:
ABI2, abi2, Abi2
Vector type:
Mammalian Expression Vector
Vector backbone:
pME18S-FL3
Resistance Gene:
Ampicillin
Expression:
Transient

Sequencing Primer:
  • Custom (774)
  • Custom (1194)
  • SV40pA-R-genewiz
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4080753
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Abl-Interactor 2 (ABI2)
Gene ID:
548798 (Xenopus tropicalis, ABI2)
Synonyms:
ABI2, abi2, Abi2
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4021734
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abl-Interactor 2 (ABI2)
Gene ID:
394360 (Xenopus laevis, ABI2)
Synonyms:
ABI2, abi2, Abi2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3845180
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abl-Interactor 2 (ABI2)
Gene ID:
548798 (Xenopus tropicalis, ABI2)
Synonyms:
ABI2, abi2, Abi2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3864889
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Abl-Interactor 2 (ABI2)
Gene ID:
537711 (Cow (Bovine), ABI2)
Synonyms:
ABI2, abi2, Abi2
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4064554
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Abl-Interactor 2 (ABI2)
Gene ID:
10152 (Human, ABI2)
Synonyms:
ABI2, abi2, Abi2
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4088689
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
  • <
  • 1

Synonyms and alternative names related to ABI2

  • abl interactor 2 (ABI2)
  • abl interactor 2 (abi2)
  • abl-interactor 2 (Abi2)
  • 8430425M24Rik
  • ABI-2
  • ABI2B
  • AblBP3
  • AI839867
  • AIP-1
  • argBPIA
  • argBPIB
  • C130078H13
  • SSH3BP2

Gene-IDs for different species

GENE IDSPECIES
459892 Pan troglodytes
537711 Bos taurus
704956 Macaca mulatta
100014852 Monodelphis domestica
100171808 Pongo abelii
100405981 Callithrix jacchus
100566563 Anolis carolinensis
10152 Homo sapiens
329165 Mus musculus
424108 Gallus gallus
488485 Canis lupus familiaris
286928 Rattus norvegicus

Protein level used designations for ABI2

  • abl interactor 2
  • abl-interactor 2
  • abelson interactor 2
  • abl binding protein 3
  • abl-binding protein 3
  • abl-interacting protein 1 (SH3-containing protein)
  • abl-interactor protein 2b
  • arg protein tyrosine kinase-binding protein
  • arg-binding protein 1
  • argBP1
  • abi-2
  • thyroid hormone responsive protein
Other products related to ABI2 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com