ABI3BP (ABI Family, Member 3 (NESH) Binding Protein, ABI3BP)

Products related to ABI3BP Gene:
129 Products
Type
  • 127
  • 2
Species
  • 85
  • 39
  • 2
  • 2
  • 1
Application
  • 77
  • 40
  • 15
  • 12
Fusion tag
  • 38
  • 18
  • 18
  • 15
  • 6
Vector Backbone
  • 12
  • 12
  • 6
  • 6
  • 6
Vector
  • 43
  • 41
  • 24
  • 8
  • 6
Insert
  • 63
  • 39
  • 13
  • 6
  • 4
Oligo-Type
  • 2
Resistance Gene
  • 59
  • 31
  • 28
  • 9
  • 2
Expression Type
  • 120
  • 50
Selectable Marker
  • 38
  • 18
  • 1
Promoter
  • 52
  • 25
  • 21
  • 15
  • 6
Format
  • 54
  • 35
  • 23
  • 17
Supplier: Log in to see

ORF Cloning-Vector holds the gene between an AflII and EcoRV cut site.

Type:
ORF
Application:
Cloning
Gene:
ABI Family, Member 3 (NESH) Binding Protein (ABI3BP)
Species:
Human
Synonyms:
ABI3BP, abi3bp, Abi3bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5720107
$70.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Mammalian Vector with ORF clone of Human ABI family, member 3 (NESH) binding protein (ABI3BP)

Type:
ORF
Application:
Protein Expression
Gene:
ABI Family, Member 3 (NESH) Binding Protein (ABI3BP)
NCBI Accession:
NM_015429,NP_056244
Species:
Human
Synonyms:
ABI3BP, abi3bp, Abi3bp
Insert length:
3228 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5334671
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see

Full length Danio rerio ABI family, member 3 (NESH) binding protein cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
ABI Family, Member 3 (NESH) Binding Protein (ABI3BP)
Gene ID:
100149890 (Zebrafish (Danio rerio), ABI3BP)
Synonyms:
ABI3BP, abi3bp, Abi3bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pME18S-FL3
Resistance Gene:
Ampicillin
Expression:
Transient

Sequencing Primer:
  • Custom (774)
  • Custom (1194)
  • SV40pA-R-genewiz
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4082912
$99.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see
ISO 9001:2008

Expression/transfection ready cDNA ORF clone of Human ABI3BP with C terminal DYKDDDDK tag is ideal for express proteins in E.coli & mammalian cells.

Type:
ORF
Application:
Protein Expression
Gene:
ABI Family, Member 3 (NESH) Binding Protein (ABI3BP)
NCBI Accession:
NM_015429
Gene ID:
25890 (Human, ABI3BP)
Synonyms:
ABI3BP, abi3bp, Abi3bp
Insert length:
3228 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4946321
$99.00
10 μg
Plus shipping costs $45.00
Available
Supplier: Log in to see

Full length Homo sapiens ABI family, member 3 (NESH) binding protein cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
ABI Family, Member 3 (NESH) Binding Protein (ABI3BP)
Gene ID:
25890 (Human, ABI3BP)
Synonyms:
ABI3BP, abi3bp, Abi3bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3812135
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Mus musculus ABI gene family, member 3 (NESH) binding protein cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
ABI Family, Member 3 (NESH) Binding Protein (ABI3BP)
Gene ID:
320712 (Mouse (Murine), ABI3BP)
Synonyms:
ABI3BP, abi3bp, Abi3bp
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4016574
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Bos taurus ABI family, member 3 (NESH) binding protein cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
ABI Family, Member 3 (NESH) Binding Protein (ABI3BP)
Gene ID:
538604 (Cow (Bovine), ABI3BP)
Synonyms:
ABI3BP, abi3bp, Abi3bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3863387
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Xenopus tropicalis ABI family, member 3 (NESH) binding protein cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
ABI Family, Member 3 (NESH) Binding Protein (ABI3BP)
Gene ID:
595083 (Xenopus tropicalis, ABI3BP)
Synonyms:
ABI3BP, abi3bp, Abi3bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4066687
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens ABI family, member 3 (NESH) binding protein cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
ABI Family, Member 3 (NESH) Binding Protein (ABI3BP)
Gene ID:
25890 (Human, ABI3BP)
Synonyms:
ABI3BP, abi3bp, Abi3bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3812133
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Mus musculus ABI gene family, member 3 (NESH) binding protein cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
ABI Family, Member 3 (NESH) Binding Protein (ABI3BP)
Gene ID:
320712 (Mouse (Murine), ABI3BP)
Synonyms:
ABI3BP, abi3bp, Abi3bp
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4016575
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Bos taurus ABI family, member 3 (NESH) binding protein cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
ABI Family, Member 3 (NESH) Binding Protein (ABI3BP)
Gene ID:
538604 (Cow (Bovine), ABI3BP)
Synonyms:
ABI3BP, abi3bp, Abi3bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3863388
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Xenopus tropicalis ABI family, member 3 (NESH) binding protein cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
ABI Family, Member 3 (NESH) Binding Protein (ABI3BP)
Gene ID:
595083 (Xenopus tropicalis, ABI3BP)
Synonyms:
ABI3BP, abi3bp, Abi3bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4066688
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Entry clone of human cDNA (ORF) without STOP codon in Gateway pDONR223 Vector.

Type:
ORF
Application:
Cloning
Gene:
ABI Family, Member 3 (NESH) Binding Protein (ABI3BP)
Gene ID:
25890 (Human, ABI3BP)
Synonyms:
ABI3BP, abi3bp, Abi3bp
Insert length:
3228 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5318707
$224.73
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
Supplier: Log in to see

Bacterial expression of Human ABI3BP with His tag

Type:
cDNA
Application:
Cloning
Gene:
ABI Family, Member 3 (NESH) Binding Protein (ABI3BP)
Species:
Human
Synonyms:
ABI3BP, abi3bp, Abi3bp
Insert length:
3228 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4372141
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Mammalian expression of Human ABI3BP with DYKDDDDK Tag,HA tag

Type:
cDNA
Application:
Protein Expression
Gene:
ABI Family, Member 3 (NESH) Binding Protein (ABI3BP)
Species:
Human
Synonyms:
ABI3BP, abi3bp, Abi3bp
Insert length:
3228 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-N-D-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag,HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4498033
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Mammalian expression of Human ABI3BP with His tag

Type:
cDNA
Application:
Protein Expression
Gene:
ABI Family, Member 3 (NESH) Binding Protein (ABI3BP)
Species:
Human
Synonyms:
ABI3BP, abi3bp, Abi3bp
Insert length:
3228 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4432769
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Mammalian expression of Human ABI3BP with HA tag

Type:
cDNA
Application:
Protein Expression
Gene:
ABI Family, Member 3 (NESH) Binding Protein (ABI3BP)
Species:
Human
Synonyms:
ABI3BP, abi3bp, Abi3bp
Insert length:
3228 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4471674
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Human ABI3BP with His-GST

Type:
cDNA
Application:
Cloning
Gene:
ABI Family, Member 3 (NESH) Binding Protein (ABI3BP)
Species:
Human
Synonyms:
ABI3BP, abi3bp, Abi3bp
Insert length:
3228 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4825957
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Human ABI3BP with His tag

Type:
cDNA
Application:
Cloning
Gene:
ABI Family, Member 3 (NESH) Binding Protein (ABI3BP)
Species:
Human
Synonyms:
ABI3BP, abi3bp, Abi3bp
Insert length:
3228 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4758049
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Human ABI3BP with His-MBP

Type:
cDNA
Application:
Cloning
Gene:
ABI Family, Member 3 (NESH) Binding Protein (ABI3BP)
Species:
Human
Synonyms:
ABI3BP, abi3bp, Abi3bp
Insert length:
3228 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4696828
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to ABI3BP

  • ABI family member 3 binding protein (ABI3BP)
  • ABI family member 3 binding protein (abi3bp)
  • ABI gene family, member 3 (NESH) binding protein (Abi3bp)
  • ABI family member 3 binding protein (Abi3bp)
  • 5033411B22Rik
  • ABI3BP
  • AI506287
  • BG172926
  • D930038M13Rik
  • eratin
  • MGC107789
  • NESHBP
  • neshbp
  • RGD1562717
  • TARSH
  • tarsh

Gene-IDs for different species

GENE IDSPECIES
25890 Homo sapiens
478544 Canis lupus familiaris
538604 Bos taurus
595083 Xenopus (Silurana) tropicalis
740047 Pan troglodytes
100154641 Sus scrofa
100222962 Taeniopygia guttata
100393956 Callithrix jacchus
100470082 Ailuropoda melanoleuca
769237 Gallus gallus
100016790 Monodelphis domestica
100062052 Equus caballus
320712 Mus musculus
363767 Rattus norvegicus
100723639 Cavia porcellus
101884149 Danio rerio

Protein level used designations for ABI3BP

  • ABI gene family member 3-binding protein
  • ABI gene family, member 3 (NESH) binding protein
  • nesh-binding protein
  • target of Nesh-SH3
  • ABI family, member 3 (NESH) binding protein
  • tarsh protein
  • target of Nesh-SH3-like
Other products related to ABI3BP such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com