ABLIM2 (Actin Binding LIM Protein Family, Member 2, ABLIM2)

Short Description: contains a zinc binding domain [RGD, Feb 2006].
More information related to gene ABLIM2.
Products related to ABLIM2 Gene:
234 Products
Type
  • 227
  • 7
Species
  • 101
  • 94
  • 37
  • 2
Oligo-Type
  • 6
  • 1
Insert
  • 97
  • 95
  • 19
  • 8
  • 6
Vector
  • 97
  • 68
  • 36
  • 13
  • 9
Vector Backbone
  • 25
  • 23
  • 23
  • 9
  • 9
Fusion tag
  • 58
  • 39
  • 35
  • 29
  • 11
Resistance Gene
  • 117
  • 52
  • 46
  • 12
  • 2
Selectable Marker
  • 77
  • 24
  • 13
  • 2
  • 1
Promoter
  • 110
  • 37
  • 34
  • 31
  • 8
Expression Type
  • 206
  • 85
  • 13
Application
  • 153
  • 53
  • 25
  • 16
  • 1
Format
  • 108
  • 81
  • 33
  • 12
Supplier: Log in to see

Full length Clone DNA of Homo sapiens actin binding LIM protein family, member 2.

Type:
cDNA
Application:
Cloning
Gene:
Actin Binding LIM Protein Family, Member 2 (ABLIM2)
Species:
Human
Synonyms:
ABLIM2, Ablim2
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3545877
€66.37
1 vial
Plus shipping costs €45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Verified forward and reverse primers for analyzing the quantitative expression of gene

Application:
Quantitative real-time PCR
Gene:
Actin Binding LIM Protein Family, Member 2
Species:
Human
Synonyms:
AI606905, C230091L11
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3192815
€69.91
1 vial
Plus shipping costs €45.00
Delivery in 15 to 19 Business Days
Supplier: Log in to see

Full length Xenopus laevis actin binding LIM protein family, member 2 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Actin Binding LIM Protein Family, Member 2 (ABLIM2)
Gene ID:
447629 (Xenopus laevis, ABLIM2)
Synonyms:
ABLIM2, Ablim2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3884665
€97.35
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Mus musculus actin-binding LIM protein 2 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Actin Binding LIM Protein Family, Member 2 (ABLIM2)
Gene ID:
231148 (Mouse (Murine), ABLIM2)
Synonyms:
ABLIM2, Ablim2
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4013715
€97.35
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Homo sapiens actin binding LIM protein family, member 2 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Actin Binding LIM Protein Family, Member 2 (ABLIM2)
Gene ID:
84448 (Human, ABLIM2)
Synonyms:
ABLIM2, Ablim2
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3991416
€97.35
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Xenopus laevis actin binding LIM protein family, member 2 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Actin Binding LIM Protein Family, Member 2 (ABLIM2)
Gene ID:
447629 (Xenopus laevis, ABLIM2)
Synonyms:
ABLIM2, Ablim2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3884666
€136.67
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Mus musculus actin-binding LIM protein 2 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Actin Binding LIM Protein Family, Member 2 (ABLIM2)
Gene ID:
231148 (Mouse (Murine), ABLIM2)
Synonyms:
ABLIM2, Ablim2
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4013714
€136.67
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens actin binding LIM protein family, member 2 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Actin Binding LIM Protein Family, Member 2 (ABLIM2)
Gene ID:
84448 (Human, ABLIM2)
Synonyms:
ABLIM2, Ablim2
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3991415
€136.67
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Entry clone of human cDNA (ORF) without STOP codon in Gateway pDONR223 Vector.

Type:
ORF
Application:
Cloning
Gene:
Actin Binding LIM Protein Family, Member 2 (ABLIM2)
Gene ID:
84448 (Human, ABLIM2)
Synonyms:
ABLIM2, Ablim2
Insert length:
1566 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5325484
€172.15
2 μg
Plus shipping costs €45.00
Delivery in 15 to 17 Business Days
Supplier: Log in to see

The actin binding LIM protein family, member 2 ORF clone is provided in a Gateway adapted entry vector for fast and convenient transfer to any compatible expression vector.

Type:
ORF
Application:
Protein Expression
Gene:
Actin Binding LIM Protein Family, Member 2 (ABLIM2)
Gene ID:
84448 (Human, ABLIM2)
Synonyms:
ABLIM2, Ablim2
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3415051
€265.49
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

The actin-binding LIM protein 2 ORF clone is provided in a Gateway adapted entry vector for fast and convenient transfer to any compatible expression vector.

Type:
ORF
Application:
Protein Expression
Gene:
Actin Binding LIM Protein Family, Member 2 (ABLIM2)
Gene ID:
231148 (Mouse (Murine), ABLIM2)
Synonyms:
ABLIM2, Ablim2
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR223-1
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3433648
€265.49
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

ORF Cloning-Vector holds the gene between an AflII and EcoRV cut site.

Type:
ORF
Application:
Cloning
Gene:
Actin Binding LIM Protein Family, Member 2 (ABLIM2)
Species:
Human
Synonyms:
ABLIM2, Ablim2
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5767373
€265.49
1 μg
Plus shipping costs €45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human ABLIM2 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Actin Binding LIM Protein Family, Member 2 (ABLIM2)
NCBI Accession:
NM_001286688,NP_001273617
Species:
Human
Synonyms:
ABLIM2, Ablim2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3308429
€283.19
10 μg
Plus shipping costs €45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

siRNA (27 mer) kit with 3 gene-specific unique siRNA duplexes and negative control for gene knockdown.

Application:
RNA Interference
Gene:
Actin Binding LIM Protein Family, Member 2
Species:
Human
Synonyms:
AI606905, C230091L11
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • ABLIM2 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3310529
€345.13
1 kit
Plus shipping costs €45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

siRNA (27 mer) kit with 3 gene-specific unique siRNA duplexes and negative control for gene knockdown.

Application:
RNA Interference
Gene:
Actin Binding LIM Protein Family, Member 2
Species:
Rat (Rattus)
Synonyms:
AI606905, C230091L11
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Ablim2 (Rat) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3353042
€345.13
1 kit
Plus shipping costs €45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

siRNA (27 mer) kit with 3 gene-specific unique siRNA duplexes and negative control for gene knockdown.

Application:
RNA Interference
Gene:
Actin Binding LIM Protein Family, Member 2
Species:
Mouse (Murine)
Synonyms:
AI606905, C230091L11
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Ablim2 (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3266394
€345.13
1 kit
Plus shipping costs €45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Individual gRNA against ABLIM2 in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Actin Binding LIM Protein Family, Member 2 (ABLIM2)
NCBI Accession:
XM_001722714
Species:
Human
Synonyms:
ABLIM2, Ablim2
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ABLIM2
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5171744
€349.56
300 μL
Plus shipping costs €45.00 and €20.00 dry ice
Available
Supplier: Log in to see

Individual gRNA against Ablim2 in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Actin Binding LIM Protein Family, Member 2 (ABLIM2)
NCBI Accession:
NM_001177695
Species:
Rat (Rattus)
Synonyms:
ABLIM2, Ablim2
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Ablim2
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5171748
€349.56
300 μL
Plus shipping costs €45.00 and €20.00 dry ice
Available
Supplier: Log in to see

Individual gRNA against Ablim2 in Lentiviral Particles with a Titer of >1x10e7 IU/mL. (Cas9 required separately)

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Actin Binding LIM Protein Family, Member 2 (ABLIM2)
NCBI Accession:
NM_177678
Species:
Mouse (Murine)
Synonyms:
ABLIM2, Ablim2
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Ablim2
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5171746
€349.56
300 μL
Plus shipping costs €45.00 and €20.00 dry ice
Available
Supplier: Log in to see

Mammalian Vector with ORF clone of Human actin binding LIM protein family, member 2 (ABLIM2) transcript variant 8

Type:
ORF
Application:
Protein Expression
Gene:
Actin Binding LIM Protein Family, Member 2 (ABLIM2)
Species:
Human
Synonyms:
ABLIM2, Ablim2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5486817
€355.75
10 μg
Plus shipping costs €45.00
Will be delivered in 16 Business Days
  • <
  • 1
  • ...

Synonyms and alternative names related to ABLIM2

  • actin binding LIM protein family member 2 (ABLIM2)
  • actin binding LIM protein family, member 2 (Ablim2)
  • actin-binding LIM protein 2 (Ablim2)
  • AI606905
  • C230091L11

Gene-IDs for different species

GENE IDSPECIES
84448 Homo sapiens
360958 Rattus norvegicus
231148 Mus musculus

Protein level used designations for ABLIM2

  • abLIM-2
  • actin binding LIM protein 2
  • actin-binding LIM protein 2
  • actin-binding LIM protein family member 2
Other products related to ABLIM2 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com