ABLIM2 (Actin Binding LIM Protein Family, Member 2, ABLIM2)

Short Description: contains a zinc binding domain [RGD, Feb 2006].
More information related to gene ABLIM2.
Products related to ABLIM2 Gene:
233 Products
Type
  • 226
  • 7
Species
  • 101
  • 93
  • 37
  • 2
Application
  • 152
  • 53
  • 25
  • 16
  • 1
Fusion tag
  • 57
  • 39
  • 35
  • 29
  • 11
Vector Backbone
  • 25
  • 23
  • 23
  • 9
  • 9
Vector
  • 96
  • 68
  • 36
  • 13
  • 9
Insert
  • 97
  • 94
  • 19
  • 8
  • 6
Oligo-Type
  • 6
  • 1
Resistance Gene
  • 117
  • 52
  • 45
  • 12
  • 2
Expression Type
  • 205
  • 85
  • 13
Selectable Marker
  • 77
  • 24
  • 13
  • 2
  • 1
Promoter
  • 110
  • 36
  • 33
  • 31
  • 8
Format
  • 107
  • 81
  • 33
  • 12
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Actin Binding LIM Protein Family, Member 2 (ABLIM2)
Gene ID:
231148 (Mouse (Murine), ABLIM2)
Synonyms:
ABLIM2, Ablim2
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4013715
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Actin Binding LIM Protein Family, Member 2 (ABLIM2)
Gene ID:
447629 (Xenopus laevis, ABLIM2)
Synonyms:
ABLIM2, Ablim2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3884665
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Actin Binding LIM Protein Family, Member 2 (ABLIM2)
Gene ID:
84448 (Human, ABLIM2)
Synonyms:
ABLIM2, Ablim2
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3991416
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Actin Binding LIM Protein Family, Member 2 (ABLIM2)
Species:
Human
Synonyms:
ABLIM2, Ablim2
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3545877
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Application:
Quantitative real-time PCR
Gene:
Actin Binding LIM Protein Family, Member 2
Species:
Human
Synonyms:
AI606905, C230091L11
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3192815
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Actin Binding LIM Protein Family, Member 2 (ABLIM2)
Gene ID:
447629 (Xenopus laevis, ABLIM2)
Synonyms:
ABLIM2, Ablim2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3884666
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Actin Binding LIM Protein Family, Member 2 (ABLIM2)
Gene ID:
84448 (Human, ABLIM2)
Synonyms:
ABLIM2, Ablim2
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3991415
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Actin Binding LIM Protein Family, Member 2 (ABLIM2)
Gene ID:
231148 (Mouse (Murine), ABLIM2)
Synonyms:
ABLIM2, Ablim2
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4013714
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Cloning
Gene:
Actin Binding LIM Protein Family, Member 2 (ABLIM2)
Gene ID:
84448 (Human, ABLIM2)
Synonyms:
ABLIM2, Ablim2
Insert length:
1566 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5325484
$194.53
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Cloning
Gene:
Actin Binding LIM Protein Family, Member 2 (ABLIM2)
Species:
Human
Synonyms:
ABLIM2, Ablim2
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5767373
$325.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Actin Binding LIM Protein Family, Member 2 (ABLIM2)
Gene ID:
84448 (Human, ABLIM2)
Synonyms:
ABLIM2, Ablim2
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3415051
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Actin Binding LIM Protein Family, Member 2 (ABLIM2)
Gene ID:
231148 (Mouse (Murine), ABLIM2)
Synonyms:
ABLIM2, Ablim2
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR223-1
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3433648
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression
Gene:
Actin Binding LIM Protein Family, Member 2 (ABLIM2)
NCBI Accession:
NM_001286688,NP_001273617
Species:
Human
Synonyms:
ABLIM2, Ablim2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3308429
$340.00
10 μg
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Actin Binding LIM Protein Family, Member 2 (ABLIM2)
NCBI Accession:
NM_032432,NP_115808
Species:
Human
Synonyms:
ABLIM2, Ablim2
Insert length:
1593 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5486810
$410.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Actin Binding LIM Protein Family, Member 2 (ABLIM2)
Species:
Human
Synonyms:
ABLIM2, Ablim2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5486817
$410.00
10 μg
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Actin Binding LIM Protein Family, Member 2 (ABLIM2)
NCBI Accession:
XM_001722714
Species:
Human
Synonyms:
ABLIM2, Ablim2
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ABLIM2
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5171744
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
Supplier: Log in to see

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Actin Binding LIM Protein Family, Member 2 (ABLIM2)
NCBI Accession:
NM_001177695
Species:
Rat (Rattus)
Synonyms:
ABLIM2, Ablim2
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Ablim2
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5171748
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
Supplier: Log in to see

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Actin Binding LIM Protein Family, Member 2 (ABLIM2)
NCBI Accession:
NM_177678
Species:
Mouse (Murine)
Synonyms:
ABLIM2, Ablim2
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Ablim2
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5171746
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
Supplier: Log in to see

Application:
RNA Interference
Gene:
Actin Binding LIM Protein Family, Member 2
Species:
Human
Synonyms:
AI606905, C230091L11
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • ABLIM2 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3310529
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Application:
RNA Interference
Gene:
Actin Binding LIM Protein Family, Member 2
Species:
Rat (Rattus)
Synonyms:
AI606905, C230091L11
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Ablim2 (Rat) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3353042
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
  • <
  • 1
  • ...

Synonyms and alternative names related to ABLIM2

  • actin binding LIM protein family member 2 (ABLIM2)
  • actin binding LIM protein family, member 2 (Ablim2)
  • actin-binding LIM protein 2 (Ablim2)
  • AI606905
  • C230091L11

Gene-IDs for different species

GENE IDSPECIES
84448 Homo sapiens
360958 Rattus norvegicus
231148 Mus musculus

Protein level used designations for ABLIM2

  • abLIM-2
  • actin binding LIM protein 2
  • actin-binding LIM protein 2
  • actin-binding LIM protein family member 2
Other products related to ABLIM2 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com