ACAA2 (Acetyl-CoA Acyltransferase 2, ACAA2)

Short Description: The encoded protein catalyzes the last step of the mitochondrial fatty acid beta-oxidation spiral. Unlike most mitochondrial matrix proteins, it contains a non-cleavable amino-terminal targeting signal. [provided by RefSeq, Jul 2008].
More information related to gene ACAA2.
Products related to ACAA2 Gene:
150 Products
Type
  • 141
  • 9
Species
  • 56
  • 44
  • 43
  • 2
  • 2
Oligo-Type
  • 6
  • 3
Insert
  • 63
  • 41
  • 21
  • 8
  • 6
Vector
  • 72
  • 36
  • 12
  • 9
  • 7
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
Fusion tag
  • 51
  • 16
  • 15
  • 10
  • 9
Resistance Gene
  • 71
  • 45
  • 20
  • 5
  • 2
Selectable Marker
  • 39
  • 26
  • 25
  • 1
Promoter
  • 53
  • 31
  • 31
  • 13
  • 8
Expression Type
  • 93
  • 51
  • 39
Application
  • 95
  • 30
  • 27
  • 16
  • 3
Format
  • 82
  • 27
  • 22
  • 19
Supplier: Log in to see

ORF Cloning-Vector holds the gene between an AflII and EcoRV cut site.

Type:
ORF
Application:
Cloning
Gene:
Acetyl-CoA Acyltransferase 2 (ACAA2)
Species:
Human
Synonyms:
ACAA2, Acaa2, acaa2, acaa2.L
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5732892
$45.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Full length Clone DNA of Rattus norvegicus acetyl-CoA acyltransferase 2.

Type:
cDNA
Application:
Cloning
Gene:
Acetyl-CoA Acyltransferase 2 (ACAA2)
NCBI Accession:
NM_130433
Species:
Rat (Rattus)
Synonyms:
ACAA2, Acaa2, acaa2, acaa2.L
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3611173
€66.37
1 vial
Plus shipping costs €45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Mus musculus acetyl-Coenzyme A acyltransferase 2 (mitochondrial 3-oxoacyl-Coenzyme A thiolase)

Type:
cDNA
Application:
Cloning
Gene:
Acetyl-CoA Acyltransferase 2 (ACAA2)
NCBI Accession:
NM_177470
Species:
Mouse (Murine)
Synonyms:
ACAA2, Acaa2, acaa2, acaa2.L
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3611172
€66.37
1 vial
Plus shipping costs €45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens acetyl-CoA acyltransferase 2.

Type:
cDNA
Application:
Cloning
Gene:
Acetyl-CoA Acyltransferase 2 (ACAA2)
Species:
Human
Synonyms:
ACAA2, Acaa2, acaa2, acaa2.L
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3611171
€66.37
1 vial
Plus shipping costs €45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Verified forward and reverse primers for analyzing the quantitative expression of gene

Application:
Quantitative real-time PCR
Gene:
Acetyl-CoA Acyltransferase 2
Species:
Mouse (Murine)
Synonyms:
DSAEC, fb59b11, zgc:56036, wu:fb59b11, 0610011L04Rik, AI255831, AI265397, D18Ertd240e
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3195361
€69.91
1 vial
Plus shipping costs €45.00
Delivery in 15 to 19 Business Days
Supplier: Log in to see

Verified forward and reverse primers for analyzing the quantitative expression of gene

Application:
Quantitative real-time PCR
Gene:
Acetyl-CoA Acyltransferase 2
Species:
Human
Synonyms:
DSAEC, fb59b11, zgc:56036, wu:fb59b11, 0610011L04Rik, AI255831, AI265397, D18Ertd240e
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3191858
€69.91
1 vial
Plus shipping costs €45.00
Delivery in 15 to 19 Business Days
Supplier: Log in to see

Verified forward and reverse primers for analyzing the quantitative expression of gene

Application:
Quantitative real-time PCR
Gene:
Acetyl-CoA Acyltransferase 2
Species:
Rat (Rattus)
Synonyms:
DSAEC, fb59b11, zgc:56036, wu:fb59b11, 0610011L04Rik, AI255831, AI265397, D18Ertd240e
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3197269
€69.91
1 vial
Plus shipping costs €45.00
Delivery in 15 to 19 Business Days
Supplier: Log in to see

Full length Xenopus laevis acetyl-CoA acyltransferase 2 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Acetyl-CoA Acyltransferase 2 (ACAA2)
Gene ID:
380424 (Xenopus laevis, ACAA2)
Synonyms:
ACAA2, Acaa2, acaa2, acaa2.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3844236
€97.35
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Bos taurus acetyl-CoA acyltransferase 2 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Acetyl-CoA Acyltransferase 2 (ACAA2)
Gene ID:
522006 (Cow (Bovine), ACAA2)
Synonyms:
ACAA2, Acaa2, acaa2, acaa2.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3860565
€97.35
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Homo sapiens acetyl-CoA acyltransferase 2 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Acetyl-CoA Acyltransferase 2 (ACAA2)
Gene ID:
10449 (Human, ACAA2)
Synonyms:
ACAA2, Acaa2, acaa2, acaa2.L
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4088971
€97.35
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Xenopus tropicalis acetyl-CoA acyltransferase 2 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Acetyl-CoA Acyltransferase 2 (ACAA2)
Gene ID:
779631 (Xenopus tropicalis, ACAA2)
Synonyms:
ACAA2, Acaa2, acaa2, acaa2.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pRKW2
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4096354
€97.35
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Xenopus laevis acetyl-CoA acyltransferase 2 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Acetyl-CoA Acyltransferase 2 (ACAA2)
Gene ID:
380424 (Xenopus laevis, ACAA2)
Synonyms:
ACAA2, Acaa2, acaa2, acaa2.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3844235
€136.67
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Bos taurus acetyl-CoA acyltransferase 2 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Acetyl-CoA Acyltransferase 2 (ACAA2)
Gene ID:
522006 (Cow (Bovine), ACAA2)
Synonyms:
ACAA2, Acaa2, acaa2, acaa2.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3860563
€136.67
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens acetyl-CoA acyltransferase 2 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Acetyl-CoA Acyltransferase 2 (ACAA2)
Gene ID:
10449 (Human, ACAA2)
Synonyms:
ACAA2, Acaa2, acaa2, acaa2.L
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4088972
€136.67
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Xenopus tropicalis acetyl-CoA acyltransferase 2 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Acetyl-CoA Acyltransferase 2 (ACAA2)
Gene ID:
779631 (Xenopus tropicalis, ACAA2)
Synonyms:
ACAA2, Acaa2, acaa2, acaa2.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pRKW2
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4096355
€136.67
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human ACAA2 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Acetyl-CoA Acyltransferase 2 (ACAA2)
NCBI Accession:
NM_006111,NP_006102
Species:
Human
Synonyms:
ACAA2, Acaa2, acaa2, acaa2.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, Stable

Empty vector controls:
ABIN4948179

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3317189
€168.14
10 μg
Plus shipping costs €45.00
Delivery in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human ACAA2 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Acetyl-CoA Acyltransferase 2 (ACAA2)
NCBI Accession:
NM_006111,NP_006102
Species:
Human
Synonyms:
ACAA2, Acaa2, acaa2, acaa2.L
Insert length:
2080 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3382324
€168.14
10 μg
Plus shipping costs €45.00
Delivery in 8 to 11 Business Days
Supplier: Log in to see

Entry clone of human cDNA (ORF) without STOP codon in Gateway pDONR223 Vector.

Type:
ORF
Application:
Cloning
Gene:
Acetyl-CoA Acyltransferase 2 (ACAA2)
Gene ID:
10449 (Human, ACAA2)
Synonyms:
ACAA2, Acaa2, acaa2, acaa2.L
Insert length:
1194 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5316949
€172.15
2 μg
Plus shipping costs €45.00
Delivery in 15 to 17 Business Days
Supplier: Log in to see

Mammalian expression of Human ACAA2 with HA tag

Type:
cDNA
Application:
Protein Expression
Gene:
Acetyl-CoA Acyltransferase 2 (ACAA2)
Species:
Human
Synonyms:
ACAA2, Acaa2, acaa2, acaa2.L
Insert length:
1194 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4471684
€243.36
500 ng
Plus shipping costs €45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Human ACAA2 with His-MBP

Type:
cDNA
Application:
Cloning
Gene:
Acetyl-CoA Acyltransferase 2 (ACAA2)
Species:
Human
Synonyms:
ACAA2, Acaa2, acaa2, acaa2.L
Insert length:
1194 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4696843
€243.36
500 ng
Plus shipping costs €45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to ACAA2

  • acetyl-CoA acyltransferase 2 (ACAA2)
  • acetyl-CoA acyltransferase 2 (Acaa2)
  • acetyl-CoA acyltransferase 2 (acaa2)
  • acetyl-Coenzyme A acyltransferase 2 (mitochondrial 3-oxoacyl-Coenzyme A thiolase) (Acaa2)
  • acetyl-CoA acyltransferase 2 L homeolog (acaa2.L)
  • 0610011L04Rik
  • AI255831
  • AI265397
  • D18Ertd240e
  • DSAEC
  • fb59b11
  • wu:fb59b11
  • zgc:56036

Gene-IDs for different species

GENE IDSPECIES
10449 Homo sapiens
170465 Rattus norvegicus
426847 Gallus gallus
522006 Bos taurus
100312959 Sus scrofa
406325 Danio rerio
100339733 Oryctolagus cuniculus
52538 Mus musculus
380424 Xenopus laevis
100715434 Cavia porcellus
490568 Canis lupus familiaris
101111925 Ovis aries musimon

Protein level used designations for ACAA2

  • 3-ketoacyl-CoA thiolase, mitochondrial
  • T1
  • acetyl-Coenzyme A acyltransferase 2
  • beta ketothiolase
  • beta-ketothiolase
  • mitochondrial 3-oxoacyl-CoA thiolase
  • mitochondrial 3-oxoacyl-Coenzyme A thiolase
  • acetyl-Coenzyme A acyltransferase 2 (mitochondrial 3-oxoacyl-Coenzyme A thiolase)
  • mitochondrial acetyl-Coenzyme A acyltransferase 2
  • acetyl-coenzyme A acyltransferase 2
  • acetyl-CoA acyltransferase
Other products related to ACAA2 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com