Acap3 (ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 3, Acap3)

Short Description: GTPase-activating protein for the ADP ribosylation factor family (Potential).
More information related to gene Acap3.
Products related to Acap3 Gene:
113 Products
Type
  • 109
  • 4
Species
  • 54
  • 29
  • 26
  • 2
  • 2
Application
  • 64
  • 26
  • 23
  • 16
Fusion tag
  • 39
  • 15
  • 11
  • 11
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
Vector
  • 42
  • 35
  • 12
  • 10
  • 9
Insert
  • 39
  • 35
  • 19
  • 8
  • 6
Oligo-Type
  • 4
Resistance Gene
  • 46
  • 41
  • 18
  • 4
  • 2
Expression Type
  • 88
  • 48
  • 13
Selectable Marker
  • 26
  • 25
  • 13
Promoter
  • 31
  • 29
  • 23
  • 13
  • 8
Format
  • 51
  • 27
  • 20
  • 15
Supplier: Log in to see

Full length Homo sapiens ArfGAP with coiled-coil, ankyrin repeat and PH domains 3 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 3 (Acap3)
Gene ID:
116983 (Human, Acap3)
Synonyms:
ACAP3, LOC100568277, Acap3
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4213656
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Bos taurus ArfGAP with coiled-coil, ankyrin repeat and PH domains 3 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 3 (Acap3)
Gene ID:
515444 (Cow (Bovine), Acap3)
Synonyms:
ACAP3, LOC100568277, Acap3
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4063031
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Mus musculus ArfGAP with coiled-coil, ankyrin repeat and PH domains 3 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 3 (Acap3)
Gene ID:
140500 (Mouse (Murine), Acap3)
Synonyms:
ACAP3, LOC100568277, Acap3
Vector type:
Cloning Vector
Vector backbone:
pYX-Asc
Resistance Gene:
Ampicillin
Promoter:
T3 Promoter

Sequencing Primer:
  • T7
  • T3
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4102171
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Mus musculus ArfGAP with coiled-coil, ankyrin repeat and PH domains 3 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 3 (Acap3)
Gene ID:
140500 (Mouse (Murine), Acap3)
Synonyms:
ACAP3, LOC100568277, Acap3
Vector type:
Cloning Vector
Vector backbone:
pYX-Asc
Resistance Gene:
Ampicillin
Promoter:
T3 Promoter

Sequencing Primer:
  • T7
  • T3
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4102168
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Xenopus tropicalis ArfGAP with coiled-coil, ankyrin repeat and PH domains 3 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 3 (Acap3)
Gene ID:
100127680 (Xenopus tropicalis, Acap3)
Synonyms:
ACAP3, LOC100568277, Acap3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3873251
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens ArfGAP with coiled-coil, ankyrin repeat and PH domains 3.

Type:
cDNA
Application:
Cloning
Gene:
ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 3 (Acap3)
NCBI Accession:
NM_030649
Species:
Human
Synonyms:
ACAP3, LOC100568277, Acap3
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3545892
$125.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens ArfGAP with coiled-coil, ankyrin repeat and PH domains 3 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 3 (Acap3)
Gene ID:
116983 (Human, Acap3)
Synonyms:
ACAP3, LOC100568277, Acap3
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4213657
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Bos taurus ArfGAP with coiled-coil, ankyrin repeat and PH domains 3 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 3 (Acap3)
Gene ID:
515444 (Cow (Bovine), Acap3)
Synonyms:
ACAP3, LOC100568277, Acap3
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4063032
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Mus musculus ArfGAP with coiled-coil, ankyrin repeat and PH domains 3 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 3 (Acap3)
Gene ID:
140500 (Mouse (Murine), Acap3)
Synonyms:
ACAP3, LOC100568277, Acap3
Vector type:
Cloning Vector
Vector backbone:
pYX-Asc
Resistance Gene:
Ampicillin
Promoter:
T3 Promoter

Sequencing Primer:
  • T7
  • T3
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4102169
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Mus musculus ArfGAP with coiled-coil, ankyrin repeat and PH domains 3 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 3 (Acap3)
Gene ID:
140500 (Mouse (Murine), Acap3)
Synonyms:
ACAP3, LOC100568277, Acap3
Vector type:
Cloning Vector
Vector backbone:
pYX-Asc
Resistance Gene:
Ampicillin
Promoter:
T3 Promoter

Sequencing Primer:
  • T7
  • T3
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4102170
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Xenopus tropicalis ArfGAP with coiled-coil, ankyrin repeat and PH domains 3 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 3 (Acap3)
Gene ID:
100127680 (Xenopus tropicalis, Acap3)
Synonyms:
ACAP3, LOC100568277, Acap3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3873250
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

The ArfGAP with coiled-coil, ankyrin repeat and PH domains 3 ORF clone is provided in a Gateway adapted entry vector for fast and convenient transfer to any compatible expression vector.

Type:
ORF
Application:
Protein Expression
Gene:
ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 3 (Acap3)
Gene ID:
116983 (Human, Acap3)
Synonyms:
ACAP3, LOC100568277, Acap3
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3412594
$300.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens ArfGAP with coiled-coil, ankyrin repeat and PH domains 3 with C terminal Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 3 (Acap3)
NCBI Accession:
NM_030649
Species:
Human
Synonyms:
ACAP3, LOC100568277, Acap3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948162

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3611406
$345.00
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens ArfGAP with coiled-coil, ankyrin repeat and PH domains 3 with C terminal HA tag.

Type:
ORF
Application:
Protein Expression
Gene:
ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 3 (Acap3)
NCBI Accession:
NM_030649
Species:
Human
Synonyms:
ACAP3, LOC100568277, Acap3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948163

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3611408
$345.00
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens ArfGAP with coiled-coil, ankyrin repeat and PH domains 3 with C terminal His tag.

Type:
ORF
Application:
Protein Expression
Gene:
ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 3 (Acap3)
NCBI Accession:
NM_030649
Species:
Human
Synonyms:
ACAP3, LOC100568277, Acap3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948165

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3611409
$345.00
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens ArfGAP with coiled-coil, ankyrin repeat and PH domains 3 with C terminal Myc tag.

Type:
ORF
Application:
Protein Expression
Gene:
ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 3 (Acap3)
NCBI Accession:
NM_030649
Species:
Human
Synonyms:
ACAP3, LOC100568277, Acap3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-Myc
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
MYC tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948164

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3611410
$345.00
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens ArfGAP with coiled-coil, ankyrin repeat and PH domains 3 with N terminal His tag.

Type:
ORF
Application:
Protein Expression
Gene:
ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 3 (Acap3)
NCBI Accession:
NM_030649
Species:
Human
Synonyms:
ACAP3, LOC100568277, Acap3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-N-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948169

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3611415
$345.00
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens ArfGAP with coiled-coil, ankyrin repeat and PH domains 3 with N terminal Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 3 (Acap3)
NCBI Accession:
NM_030649
Species:
Human
Synonyms:
ACAP3, LOC100568277, Acap3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-N-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948166

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3611412
$345.00
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens ArfGAP with coiled-coil, ankyrin repeat and PH domains 3 with N terminal HA tag.

Type:
ORF
Application:
Protein Expression
Gene:
ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 3 (Acap3)
NCBI Accession:
NM_030649
Species:
Human
Synonyms:
ACAP3, LOC100568277, Acap3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-N-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948167

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3611414
$345.00
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens ArfGAP with coiled-coil, ankyrin repeat and PH domains 3 with N terminal Myc tag.

Type:
ORF
Application:
Protein Expression
Gene:
ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 3 (Acap3)
NCBI Accession:
NM_030649
Species:
Human
Synonyms:
ACAP3, LOC100568277, Acap3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-N-Myc
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
MYC tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948168

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3611416
$345.00
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to Acap3

  • ArfGAP with coiled-coil, ankyrin repeat and PH domains 3 (ACAP3)
  • arf-GAP with coiled-coil, ANK repeat and PH domain-containing protein 3 (LOC100568277)
  • ArfGAP with coiled-coil, ankyrin repeat and PH domains 3 (Acap3)
  • CENTB5
  • Centb5
  • Kiaa1716-hp
  • mKIAA1716

Gene-IDs for different species

GENE IDSPECIES
704910 Macaca mulatta
100524443 Sus scrofa
100568277 Anolis carolinensis
116983 Homo sapiens
515444 Bos taurus
140500 Mus musculus
313772 Rattus norvegicus

Protein level used designations for Acap3

  • ArfGAP with coiled-coil, ankyrin repeat and PH domains 3
  • arf-GAP with coiled-coil, ANK repeat and PH domain-containing protein 3
  • centaurin, beta 5
  • centaurin-beta-5
  • cnt-b5
Other products related to Acap3 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com