Acap3 (ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 3, Acap3)

Short Description: GTPase-activating protein for the ADP ribosylation factor family (Potential).
More information related to gene Acap3.
Products related to Acap3 Gene:
Type
  • 102
  • 3
Species
  • 50
  • 27
  • 26
  • 1
  • 1
Application
  • 61
  • 21
  • 21
  • 16
Fusion tag
  • 32
  • 14
  • 11
  • 11
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
Vector
  • 38
  • 35
  • 12
  • 9
  • 7
Insert
  • 35
  • 33
  • 18
  • 8
  • 6
Oligo-Type
  • 3
Resistance Gene
  • 45
  • 35
  • 18
  • 4
  • 2
Expression Type
  • 84
  • 47
  • 13
Selectable Marker
  • 26
  • 24
  • 13
Promoter
  • 30
  • 28
  • 20
  • 12
  • 8
Format
  • 48
  • 27
  • 20
  • 10
105 Products

Type:
cDNA
Application:
Cloning
Gene:
ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 3 (Acap3)
NCBI Accession:
NM_030649
Species:
Human
Synonyms:
ACAP3, LOC100568277, Acap3
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3545892
$158.97
1 vial
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 3 (Acap3)
Gene ID:
100127680 (Xenopus tropicalis, Acap3)
Synonyms:
ACAP3, LOC100568277, Acap3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3873250
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 3 (Acap3)
Gene ID:
116983 (Human, Acap3)
Synonyms:
ACAP3, LOC100568277, Acap3
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4213657
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 3 (Acap3)
Gene ID:
515444 (Cow, Acap3)
Synonyms:
ACAP3, LOC100568277, Acap3
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4063032
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 3 (Acap3)
Gene ID:
140500 (Mouse, Acap3)
Synonyms:
ACAP3, LOC100568277, Acap3
Vector type:
Cloning Vector
Vector backbone:
pYX-Asc
Resistance Gene:
Ampicillin
Promoter:
T3 Promoter

Sequencing Primer:
  • T7
  • T3
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4102170
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 3 (Acap3)
Gene ID:
140500 (Mouse, Acap3)
Synonyms:
ACAP3, LOC100568277, Acap3
Vector type:
Cloning Vector
Vector backbone:
pYX-Asc
Resistance Gene:
Ampicillin
Promoter:
T3 Promoter

Sequencing Primer:
  • T7
  • T3
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4102169
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 3 (Acap3)
Gene ID:
116983 (Human, Acap3)
Synonyms:
ACAP3, LOC100568277, Acap3
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3412594
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 3 (Acap3)
NCBI Accession:
NM_030649
Gene ID:
116983 (Human, Acap3)
Synonyms:
ACAP3, LOC100568277, Acap3
Insert length:
2505 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4944803
$379.00
10 μg
Plus shipping costs $45.00
Will be delivered in 31 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 3 (Acap3)
NCBI Accession:
NM_207223
Species:
Mouse
Synonyms:
ACAP3, LOC100568277, Acap3
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Acap3
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5128308
$420.00
300 μL
Plus shipping costs $45.00 and $24.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 3 (Acap3)
NCBI Accession:
NM_030649
Species:
Human
Synonyms:
ACAP3, LOC100568277, Acap3
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ACAP3
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5128306
$420.00
300 μL
Plus shipping costs $45.00 and $24.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 3 (Acap3)
NCBI Accession:
NM_001107999
Species:
Rat
Synonyms:
ACAP3, LOC100568277, Acap3
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Acap3
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5128310
$420.00
300 μL
Plus shipping costs $45.00 and $24.00 dry ice
Available

Type:
ORF
Application:
Protein Expression
Gene:
ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 3 (Acap3)
NCBI Accession:
NM_030649,NP_085152
Species:
Human
Synonyms:
ACAP3, LOC100568277, Acap3
Insert length:
2505 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5418277
$433.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Application:
RNA Interference
Gene:
ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 3
Species:
Mouse
Synonyms:
CENTB5, Centb5, Kiaa1716-hp, mKIAA1716
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Centb5 (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3347393
$440.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 3
Species:
Rat
Synonyms:
CENTB5, Centb5, Kiaa1716-hp, mKIAA1716
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Acap3 (Rat) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3351491
$440.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 3
Species:
Human
Synonyms:
CENTB5, Centb5, Kiaa1716-hp, mKIAA1716
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • ACAP3 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3311603
$440.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 3 (Acap3)
NCBI Accession:
NM_030649
Species:
Human
Synonyms:
ACAP3, LOC100568277, Acap3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948162

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3611406
$456.62
1 vial
Plus shipping costs $45.00
Delivery in 17 to 23 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 3 (Acap3)
NCBI Accession:
NM_030649
Species:
Human
Synonyms:
ACAP3, LOC100568277, Acap3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948163

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3611408
$456.62
1 vial
Plus shipping costs $45.00
Delivery in 17 to 23 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 3 (Acap3)
NCBI Accession:
NM_030649
Species:
Human
Synonyms:
ACAP3, LOC100568277, Acap3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948165

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3611409
$456.62
1 vial
Plus shipping costs $45.00
Delivery in 17 to 23 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 3 (Acap3)
NCBI Accession:
NM_030649
Species:
Human
Synonyms:
ACAP3, LOC100568277, Acap3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-Myc
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
MYC tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948164

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3611410
$456.62
1 vial
Plus shipping costs $45.00
Delivery in 17 to 23 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
ArfGAP with Coiled-Coil, Ankyrin Repeat and PH Domains 3 (Acap3)
NCBI Accession:
NM_030649
Species:
Human
Synonyms:
ACAP3, LOC100568277, Acap3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-N-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948166

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3611412
$456.62
1 vial
Plus shipping costs $45.00
Delivery in 17 to 23 Business Days
  • <
  • 1

Synonyms and alternative names related to Acap3

  • ArfGAP with coiled-coil, ankyrin repeat and PH domains 3 (ACAP3)
  • arf-GAP with coiled-coil, ANK repeat and PH domain-containing protein 3 (LOC100568277)
  • ArfGAP with coiled-coil, ankyrin repeat and PH domains 3 (Acap3)
  • CENTB5
  • Centb5
  • Kiaa1716-hp
  • mKIAA1716

Gene-IDs for different species

GENE IDSPECIES
704910 Macaca mulatta
100524443 Sus scrofa
100568277 Anolis carolinensis
116983 Homo sapiens
515444 Bos taurus
140500 Mus musculus
313772 Rattus norvegicus

Protein level used designations for Acap3

  • ArfGAP with coiled-coil, ankyrin repeat and PH domains 3
  • arf-GAP with coiled-coil, ANK repeat and PH domain-containing protein 3
  • centaurin, beta 5
  • centaurin-beta-5
  • cnt-b5
Other products related to Acap3 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com