ACER1 (Alkaline Ceramidase 1, ACER1)

Short Description: Ceramides are synthesized during epidermal differentiation and accumulate within the interstices of the stratum corneum, where they represent critical components of the epidermal permeability barrier. Excess cellular ceramide can trigger antimitogenic signals and induce apoptosis, and the ceramide metabolites sphingosine and sphingosine-1-phosphate (S1P) are important bioregulatory molecules. Ceramide hydrolysis in the nucleated cell layers regulates keratinocyte proliferation and apoptosis in response to external stress. Ceramide hydrolysis also occurs at the stratum corneum, releasing free sphingoid base that functions as an endogenous antimicrobial agent. ACER1 is highly expressed in epidermis and catalyzes the hydrolysis of very long chain ceramides to generate sphingosine (Houben et al., 2006 [PubMed 16477081]\; Sun et al., 2008 [PubMed 17713573]).[supplied by OMIM, Jul 2010].
More information related to gene ACER1.
Products related to ACER1 Gene:
99 Products
Type
  • 94
  • 5
Species
  • 38
  • 30
  • 25
  • 2
  • 2
Application
  • 50
  • 28
  • 23
  • 16
Fusion tag
  • 40
  • 15
  • 10
  • 9
  • 6
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 5
Vector
  • 33
  • 29
  • 12
  • 10
  • 9
Insert
  • 40
  • 20
  • 18
  • 8
  • 6
Oligo-Type
  • 5
Resistance Gene
  • 36
  • 36
  • 18
  • 4
  • 2
Expression Type
  • 86
  • 46
  • 2
Selectable Marker
  • 29
  • 24
  • 2
Promoter
  • 30
  • 30
  • 12
  • 9
  • 8
Format
  • 35
  • 27
  • 21
  • 16
Supplier: Log in to see

Mammalian Vector with ORF clone of Human alkaline ceramidase 1 (ACER1)

Type:
ORF
Application:
Protein Expression
Gene:
Alkaline Ceramidase 1 (ACER1)
NCBI Accession:
NM_133492,NP_597999
Species:
Human
Synonyms:
ACER1, acer1, Acer1
Insert length:
795 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5386466
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see

Full length Danio rerio alkaline ceramidase 1 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Alkaline Ceramidase 1 (ACER1)
Gene ID:
550266 (Zebrafish (Danio rerio), ACER1)
Synonyms:
ACER1, acer1, Acer1
Vector type:
Mammalian Expression Vector
Vector backbone:
pME18S-FL3
Resistance Gene:
Ampicillin
Expression:
Transient

Sequencing Primer:
  • Custom (774)
  • Custom (1194)
  • SV40pA-R-genewiz
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4077368
$99.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see
ISO 9001:2008

Expression/transfection ready cDNA ORF clone of Human ACER1 with C terminal DYKDDDDK tag is ideal for express proteins in E.coli & mammalian cells.

Type:
ORF
Application:
Protein Expression
Gene:
Alkaline Ceramidase 1 (ACER1)
NCBI Accession:
NM_133492
Gene ID:
125981 (Human, ACER1)
Synonyms:
ACER1, acer1, Acer1
Insert length:
795 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4941817
$99.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 6 Business Days
Supplier: Log in to see

Full length Mus musculus alkaline ceramidase 1 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Alkaline Ceramidase 1 (ACER1)
Gene ID:
171168 (Mouse (Murine), ACER1)
Synonyms:
ACER1, acer1, Acer1
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3992834
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Xenopus tropicalis alkaline ceramidase 1 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Alkaline Ceramidase 1 (ACER1)
Gene ID:
100127603 (Xenopus tropicalis, ACER1)
Synonyms:
ACER1, acer1, Acer1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS107
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T3 Promoter
Expression:
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4028216
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Homo sapiens alkaline ceramidase 1 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Alkaline Ceramidase 1 (ACER1)
Gene ID:
125981 (Human, ACER1)
Synonyms:
ACER1, acer1, Acer1
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4011266
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Homo sapiens alkaline ceramidase 1 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Alkaline Ceramidase 1 (ACER1)
Gene ID:
125981 (Human, ACER1)
Synonyms:
ACER1, acer1, Acer1
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4011267
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Bos taurus alkaline ceramidase 1 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Alkaline Ceramidase 1 (ACER1)
Gene ID:
518021 (Cow (Bovine), ACER1)
Synonyms:
ACER1, acer1, Acer1
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4063216
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Clone DNA of Rattus norvegicus alkaline ceramidase 1

Type:
cDNA
Application:
Cloning
Gene:
Alkaline Ceramidase 1 (ACER1)
NCBI Accession:
NM_001106875
Species:
Rat (Rattus)
Synonyms:
ACER1, acer1, Acer1
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3545901
$125.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Danio rerio alkaline ceramidase 1 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Alkaline Ceramidase 1 (ACER1)
Gene ID:
550266 (Zebrafish (Danio rerio), ACER1)
Synonyms:
ACER1, acer1, Acer1
Vector type:
Mammalian Expression Vector
Vector backbone:
pME18S-FL3
Resistance Gene:
Ampicillin
Expression:
Transient

Sequencing Primer:
  • Custom (774)
  • Custom (1194)
  • SV40pA-R-genewiz
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4077367
$139.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Mus musculus alkaline ceramidase 1 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Alkaline Ceramidase 1 (ACER1)
Gene ID:
171168 (Mouse (Murine), ACER1)
Synonyms:
ACER1, acer1, Acer1
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3992833
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Xenopus tropicalis alkaline ceramidase 1 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Alkaline Ceramidase 1 (ACER1)
Gene ID:
100127603 (Xenopus tropicalis, ACER1)
Synonyms:
ACER1, acer1, Acer1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS107
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T3 Promoter
Expression:
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4028217
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens alkaline ceramidase 1 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Alkaline Ceramidase 1 (ACER1)
Gene ID:
125981 (Human, ACER1)
Synonyms:
ACER1, acer1, Acer1
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4011268
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens alkaline ceramidase 1 cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Alkaline Ceramidase 1 (ACER1)
Gene ID:
125981 (Human, ACER1)
Synonyms:
ACER1, acer1, Acer1
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4011269
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Bos taurus alkaline ceramidase 1 cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Alkaline Ceramidase 1 (ACER1)
Gene ID:
518021 (Cow (Bovine), ACER1)
Synonyms:
ACER1, acer1, Acer1
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4063217
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

The alkaline ceramidase 1 ORF clone is provided in a Gateway adapted entry vector for fast and convenient transfer to any compatible expression vector.

Type:
ORF
Application:
Protein Expression
Gene:
Alkaline Ceramidase 1 (ACER1)
Gene ID:
125981 (Human, ACER1)
Synonyms:
ACER1, acer1, Acer1
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3414643
$300.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

ORF Cloning-Vector holds the gene between an AflII and EcoRV cut site.

Type:
ORF
Application:
Cloning
Gene:
Alkaline Ceramidase 1 (ACER1)
NCBI Accession:
NM_133492
Species:
Human
Synonyms:
ACER1, acer1, Acer1
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5735911
$375.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Rat Acer1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Alkaline Ceramidase 1 (ACER1)
NCBI Accession:
NM_001106875,NP_001100345
Species:
Rat (Rattus)
Synonyms:
ACER1, acer1, Acer1
Insert length:
822 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3308517
$410.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Mammalian Vector with ORF clone of Rat alkaline ceramidase 1 (Acer1)

Type:
ORF
Application:
Protein Expression
Gene:
Alkaline Ceramidase 1 (ACER1)
NCBI Accession:
NM_001106875,NP_001100345
Species:
Rat (Rattus)
Synonyms:
ACER1, acer1, Acer1
Insert length:
822 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5386467
$410.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human ACER1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Alkaline Ceramidase 1 (ACER1)
NCBI Accession:
NM_133492,NP_597999
Species:
Human
Synonyms:
ACER1, acer1, Acer1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3320603
$410.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days
  • <
  • 1

Synonyms and alternative names related to ACER1

  • alkaline ceramidase 1 (ACER1)
  • alkaline ceramidase 1 (acer1)
  • alkaline ceramidase 1 (Acer1)
  • 2310024P18Rik
  • AI662009
  • ALKCDase1
  • Alkcdase1
  • ASAH3
  • asah3
  • Asah3
  • Cer1
  • zgc:110285

Gene-IDs for different species

GENE IDSPECIES
518021 Bos taurus
611739 Canis lupus familiaris
699093 Macaca mulatta
100127603 Xenopus (Silurana) tropicalis
100357548 Oryctolagus cuniculus
468681 Pan troglodytes
550266 Danio rerio
125981 Homo sapiens
171168 Mus musculus
301118 Rattus norvegicus

Protein level used designations for ACER1

  • N-acylsphingosine amidohydrolase (alkaline ceramidase) 3
  • alkaline ceramidase 1
  • N-acylsphingosine amidohydrolase 3
  • acylsphingosine deacylase 3
  • alkCDase 1
  • alkaline CDase 1
  • alkaline cdase 1
  • maCER1
Other products related to ACER1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com