ACER1 (Alkaline Ceramidase 1, ACER1)

Short Description: Ceramides are synthesized during epidermal differentiation and accumulate within the interstices of the stratum corneum, where they represent critical components of the epidermal permeability barrier. Excess cellular ceramide can trigger antimitogenic signals and induce apoptosis, and the ceramide metabolites sphingosine and sphingosine-1-phosphate (S1P) are important bioregulatory molecules. Ceramide hydrolysis in the nucleated cell layers regulates keratinocyte proliferation and apoptosis in response to external stress. Ceramide hydrolysis also occurs at the stratum corneum, releasing free sphingoid base that functions as an endogenous antimicrobial agent. ACER1 is highly expressed in epidermis and catalyzes the hydrolysis of very long chain ceramides to generate sphingosine (Houben et al., 2006 [PubMed 16477081]\; Sun et al., 2008 [PubMed 17713573]).[supplied by OMIM, Jul 2010].
More information related to gene ACER1.
Products related to ACER1 Gene:
99 Products
  • 94
  • 5
  • 38
  • 30
  • 25
  • 2
  • 2
  • 50
  • 28
  • 23
  • 16
Fusion tag
  • 40
  • 15
  • 10
  • 9
  • 6
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 5
  • 33
  • 29
  • 12
  • 10
  • 9
  • 40
  • 20
  • 18
  • 8
  • 6
  • 5
Resistance Gene
  • 36
  • 36
  • 18
  • 4
  • 2
Expression Type
  • 86
  • 46
  • 2
Selectable Marker
  • 29
  • 24
  • 2
  • 30
  • 30
  • 12
  • 9
  • 8
  • 35
  • 27
  • 21
  • 16
Supplier: Log in to see

Protein Expression
Alkaline Ceramidase 1 (ACER1)
NCBI Accession:
ACER1, acer1, Acer1
Insert length:
795 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5386466
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see

Protein Expression, Cloning
Alkaline Ceramidase 1 (ACER1)
Gene ID:
550266 (Zebrafish (Danio rerio), ACER1)
ACER1, acer1, Acer1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Custom (774)
  • Custom (1194)
  • SV40pA-R-genewiz
Glycerol Stock
-80 °C
Catalog No. ABIN4077368
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see
ISO 9001:2008

Protein Expression
Alkaline Ceramidase 1 (ACER1)
NCBI Accession:
Gene ID:
125981 (Human, ACER1)
ACER1, acer1, Acer1
Insert length:
795 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
RT/-20 °C
Catalog No. ABIN4941817
10 μg
Plus shipping costs $45.00
Delivery in 4 to 6 Business Days
Supplier: Log in to see

Alkaline Ceramidase 1 (ACER1)
Gene ID:
171168 (Mouse (Murine), ACER1)
ACER1, acer1, Acer1
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3992834
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression, Cloning
Alkaline Ceramidase 1 (ACER1)
Gene ID:
100127603 (Xenopus tropicalis, ACER1)
ACER1, acer1, Acer1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T3 Promoter
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
Glycerol Stock
-80 °C
Catalog No. ABIN4028216
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Alkaline Ceramidase 1 (ACER1)
Gene ID:
125981 (Human, ACER1)
ACER1, acer1, Acer1
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4011266
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Alkaline Ceramidase 1 (ACER1)
Gene ID:
125981 (Human, ACER1)
ACER1, acer1, Acer1
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4011267
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression, Cloning
Alkaline Ceramidase 1 (ACER1)
Gene ID:
518021 (Cow (Bovine), ACER1)
ACER1, acer1, Acer1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4063216
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Alkaline Ceramidase 1 (ACER1)
NCBI Accession:
Rat (Rattus)
ACER1, acer1, Acer1
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13(-21)
  • M13 rev
Catalog No. ABIN3545901
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Protein Expression, Cloning
Alkaline Ceramidase 1 (ACER1)
Gene ID:
550266 (Zebrafish (Danio rerio), ACER1)
ACER1, acer1, Acer1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Custom (774)
  • Custom (1194)
  • SV40pA-R-genewiz
Glycerol Stock
-80 °C
Catalog No. ABIN4077367
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression, Cloning
Alkaline Ceramidase 1 (ACER1)
Gene ID:
100127603 (Xenopus tropicalis, ACER1)
ACER1, acer1, Acer1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T3 Promoter
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
Glycerol Stock
-80 °C
Catalog No. ABIN4028217
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Alkaline Ceramidase 1 (ACER1)
Gene ID:
171168 (Mouse (Murine), ACER1)
ACER1, acer1, Acer1
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3992833
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Alkaline Ceramidase 1 (ACER1)
Gene ID:
125981 (Human, ACER1)
ACER1, acer1, Acer1
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4011269
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Alkaline Ceramidase 1 (ACER1)
Gene ID:
125981 (Human, ACER1)
ACER1, acer1, Acer1
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4011268
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression, Cloning
Alkaline Ceramidase 1 (ACER1)
Gene ID:
518021 (Cow (Bovine), ACER1)
ACER1, acer1, Acer1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4063217
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression
Alkaline Ceramidase 1 (ACER1)
Gene ID:
125981 (Human, ACER1)
ACER1, acer1, Acer1
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3414643
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Alkaline Ceramidase 1 (ACER1)
NCBI Accession:
ACER1, acer1, Acer1
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5735911
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Protein Expression
Alkaline Ceramidase 1 (ACER1)
NCBI Accession:
Rat (Rattus)
ACER1, acer1, Acer1
Insert length:
822 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
Catalog No. ABIN3308517
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Protein Expression
Alkaline Ceramidase 1 (ACER1)
NCBI Accession:
Rat (Rattus)
ACER1, acer1, Acer1
Insert length:
822 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5386467
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Protein Expression
Alkaline Ceramidase 1 (ACER1)
NCBI Accession:
ACER1, acer1, Acer1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
Catalog No. ABIN3320603
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days
  • <
  • 1

Synonyms and alternative names related to ACER1

  • alkaline ceramidase 1 (ACER1)
  • alkaline ceramidase 1 (acer1)
  • alkaline ceramidase 1 (Acer1)
  • 2310024P18Rik
  • AI662009
  • ALKCDase1
  • Alkcdase1
  • ASAH3
  • asah3
  • Asah3
  • Cer1
  • zgc:110285

Gene-IDs for different species

518021 Bos taurus
611739 Canis lupus familiaris
699093 Macaca mulatta
100127603 Xenopus (Silurana) tropicalis
100357548 Oryctolagus cuniculus
468681 Pan troglodytes
550266 Danio rerio
125981 Homo sapiens
171168 Mus musculus
301118 Rattus norvegicus

Protein level used designations for ACER1

  • N-acylsphingosine amidohydrolase (alkaline ceramidase) 3
  • alkaline ceramidase 1
  • N-acylsphingosine amidohydrolase 3
  • acylsphingosine deacylase 3
  • alkCDase 1
  • alkaline CDase 1
  • alkaline cdase 1
  • maCER1
Other products related to ACER1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website