ACER2 (Alkaline Ceramidase 2, ACER2)

Short Description: The sphingolipid metabolite sphingosine-1-phosphate promotes cell proliferation and survival, whereas its precursor, sphingosine, has the opposite effect. The ceramidase ACER2 hydrolyzes very long chain ceramides to generate sphingosine (Xu et al., 2006 [PubMed 16940153]).[supplied by OMIM, Jul 2010].
More information related to gene ACER2.
Products related to ACER2 Gene:
  • 107
  • 2
  • 48
  • 32
  • 26
  • 2
  • 1
  • 67
  • 21
  • 20
  • 16
Fusion tag
  • 34
  • 15
  • 12
  • 11
  • 8
Vector Backbone
  • 8
  • 8
  • 8
  • 6
  • 6
  • 40
  • 39
  • 12
  • 9
  • 6
  • 37
  • 36
  • 18
  • 8
  • 6
  • 2
Resistance Gene
  • 47
  • 34
  • 22
  • 4
  • 2
Expression Type
  • 90
  • 46
  • 13
  • 2
Selectable Marker
  • 26
  • 26
  • 13
  • 32
  • 28
  • 24
  • 12
  • 8
  • 47
  • 27
  • 24
  • 10
109 Products

Alkaline Ceramidase 2 (ACER2)
NCBI Accession:
ACER2, acer2.S, acer2, Acer2
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13(-21)
  • M13 rev
Catalog No. ABIN3545902
1 vial
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Alkaline Ceramidase 2 (ACER2)
Gene ID:
340485 (Human, ACER2)
ACER2, acer2.S, acer2, Acer2
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3470658
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Alkaline Ceramidase 2 (ACER2)
Gene ID:
549870 (Xenopus tropicalis, ACER2)
ACER2, acer2.S, acer2, Acer2
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T3 Promoter
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
Glycerol Stock
-80 °C
Catalog No. ABIN4027201
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Alkaline Ceramidase 2 (ACER2)
Gene ID:
549870 (Xenopus tropicalis, ACER2)
ACER2, acer2.S, acer2, Acer2
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4030761
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Alkaline Ceramidase 2 (ACER2)
Gene ID:
779231 (Xenopus laevis, ACER2)
ACER2, acer2.S, acer2, Acer2
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4069408
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Alkaline Ceramidase 2 (ACER2)
Gene ID:
230379 (Mouse, ACER2)
ACER2, acer2.S, acer2, Acer2
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
T3 Promoter

Sequencing Primer:
  • T7
  • T3
Glycerol Stock
-80 °C
Catalog No. ABIN4102677
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression
Alkaline Ceramidase 2 (ACER2)
NCBI Accession:
ACER2, acer2.S, acer2, Acer2
Insert length:
660 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
Catalog No. ABIN3308519
10 μg
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Protein Expression
Alkaline Ceramidase 2 (ACER2)
NCBI Accession:
ACER2, acer2.S, acer2, Acer2
Insert length:
690 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
Catalog No. ABIN3308520
10 μg
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Alkaline Ceramidase 2 (ACER2)
ACER2, acer2.S, acer2, Acer2
Insert length:
681 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4696870
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Alkaline Ceramidase 2 (ACER2)
ACER2, acer2.S, acer2, Acer2
Insert length:
681 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4825999
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Protein Expression
Alkaline Ceramidase 2 (ACER2)
Gene ID:
340485 (Human, ACER2)
ACER2, acer2.S, acer2, Acer2
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3413578
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
ISO 9001:2008

Protein Expression
Alkaline Ceramidase 2 (ACER2)
NCBI Accession:
Gene ID:
340485 (Human, ACER2)
ACER2, acer2.S, acer2, Acer2
Insert length:
828 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
RT/-20 °C
Catalog No. ABIN4933643
10 μg
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression
Alkaline Ceramidase 2 (ACER2)
NCBI Accession:
ACER2, acer2.S, acer2, Acer2
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
Catalog No. ABIN3611654
1 vial
Plus shipping costs $45.00
Delivery in 17 to 23 Business Days

Protein Expression
Alkaline Ceramidase 2 (ACER2)
NCBI Accession:
ACER2, acer2.S, acer2, Acer2
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter
Fusion Tag:
His tag

Empty vector controls:

Sequencing Primer:
Catalog No. ABIN3611657
1 vial
Plus shipping costs $45.00
Delivery in 17 to 23 Business Days

Protein Expression
Alkaline Ceramidase 2 (ACER2)
NCBI Accession:
ACER2, acer2.S, acer2, Acer2
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter
Fusion Tag:
HA tag

Empty vector controls:

Sequencing Primer:
Catalog No. ABIN3611656
1 vial
Plus shipping costs $45.00
Delivery in 17 to 23 Business Days

Protein Expression
Alkaline Ceramidase 2 (ACER2)
NCBI Accession:
ACER2, acer2.S, acer2, Acer2
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter
Fusion Tag:
MYC tag

Empty vector controls:

Sequencing Primer:
Catalog No. ABIN3611658
1 vial
Plus shipping costs $45.00
Delivery in 17 to 23 Business Days

Protein Expression
Alkaline Ceramidase 2 (ACER2)
NCBI Accession:
ACER2, acer2.S, acer2, Acer2
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
Catalog No. ABIN3611660
1 vial
Plus shipping costs $45.00
Delivery in 17 to 23 Business Days

Protein Expression
Alkaline Ceramidase 2 (ACER2)
NCBI Accession:
ACER2, acer2.S, acer2, Acer2
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter
Fusion Tag:
HA tag

Empty vector controls:

Sequencing Primer:
Catalog No. ABIN3611662
1 vial
Plus shipping costs $45.00
Delivery in 17 to 23 Business Days

Protein Expression
Alkaline Ceramidase 2 (ACER2)
NCBI Accession:
ACER2, acer2.S, acer2, Acer2
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter
Fusion Tag:
His tag

Empty vector controls:

Sequencing Primer:
Catalog No. ABIN3611663
1 vial
Plus shipping costs $45.00
Delivery in 17 to 23 Business Days

Protein Expression
Alkaline Ceramidase 2 (ACER2)
NCBI Accession:
ACER2, acer2.S, acer2, Acer2
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter
Fusion Tag:
MYC tag

Empty vector controls:

Sequencing Primer:
Catalog No. ABIN3611664
1 vial
Plus shipping costs $45.00
Delivery in 17 to 23 Business Days
  • <
  • 1

Synonyms and alternative names related to ACER2

  • alkaline ceramidase 2 (ACER2)
  • alkaline ceramidase 2 S homeolog (acer2.S)
  • alkaline ceramidase 2 (acer2)
  • alkaline ceramidase 2 (Acer2)
  • 2410116I05Rik
  • ALKCDase2
  • ASAH3L
  • asah3l
  • Asah3l
  • CRG-L1
  • maCER2

Gene-IDs for different species

481553 Canis lupus familiaris
779231 Xenopus laevis
100337862 Oryctolagus cuniculus
465015 Pan troglodytes
540732 Bos taurus
549870 Xenopus (Silurana) tropicalis
100528685 Ictalurus punctatus
340485 Homo sapiens
230379 Mus musculus
313339 Rattus norvegicus

Protein level used designations for ACER2

  • alkaline ceramidase 2
  • N-acylsphingosine amidohydrolase 3-like
  • putative protein, with at least 4 transmembrane domains, of eukaryotic origin (5H174)
  • alkCDase 2
  • alkaline CDase 2
  • ceramide hydrolase
  • haCER2
  • cancer related gene-liver 1 (CRG-L1)
  • cancer-related gene liver 1 protein
Other products related to ACER2 such as antibodies, ELISA kits and high-purity proteins are available on our partner website