ACER2 (Alkaline Ceramidase 2, ACER2)

Short Description: The sphingolipid metabolite sphingosine-1-phosphate promotes cell proliferation and survival, whereas its precursor, sphingosine, has the opposite effect. The ceramidase ACER2 hydrolyzes very long chain ceramides to generate sphingosine (Xu et al., 2006 [PubMed 16940153]).[supplied by OMIM, Jul 2010].
More information related to gene ACER2.
Products related to ACER2 Gene:
118 Products
Type
  • 114
  • 4
Species
  • 51
  • 35
  • 26
  • 4
  • 2
Application
  • 70
  • 26
  • 24
  • 16
Fusion tag
  • 41
  • 17
  • 12
  • 11
  • 8
Vector Backbone
  • 8
  • 8
  • 8
  • 6
  • 6
Vector
  • 45
  • 39
  • 12
  • 9
  • 8
Insert
  • 41
  • 37
  • 20
  • 8
  • 6
Oligo-Type
  • 4
Resistance Gene
  • 49
  • 39
  • 22
  • 4
  • 2
Expression Type
  • 95
  • 48
  • 13
  • 4
Selectable Marker
  • 28
  • 26
  • 13
Promoter
  • 34
  • 30
  • 27
  • 12
  • 8
Format
  • 51
  • 27
  • 24
  • 15
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Alkaline Ceramidase 2 (ACER2)
Gene ID:
549870 (Xenopus tropicalis, ACER2)
Synonyms:
ACER2, acer2.S, acer2, Acer2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS108
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4030760
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Alkaline Ceramidase 2 (ACER2)
Gene ID:
549870 (Xenopus tropicalis, ACER2)
Synonyms:
ACER2, acer2.S, acer2, Acer2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS107
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T3 Promoter
Expression:
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4027202
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Alkaline Ceramidase 2 (ACER2)
Gene ID:
779231 (Xenopus laevis, ACER2)
Synonyms:
ACER2, acer2.S, acer2, Acer2
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4069409
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Alkaline Ceramidase 2 (ACER2)
Gene ID:
230379 (Mouse (Murine), ACER2)
Synonyms:
ACER2, acer2.S, acer2, Acer2
Vector type:
Cloning Vector
Vector backbone:
pYX-Asc
Resistance Gene:
Ampicillin
Promoter:
T3 Promoter

Sequencing Primer:
  • T7
  • T3
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4102676
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Alkaline Ceramidase 2 (ACER2)
Gene ID:
340485 (Human, ACER2)
Synonyms:
ACER2, acer2.S, acer2, Acer2
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3470659
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Alkaline Ceramidase 2 (ACER2)
NCBI Accession:
NM_139306
Species:
Mouse (Murine)
Synonyms:
ACER2, acer2.S, acer2, Acer2
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Catalog No. ABIN3545902
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Alkaline Ceramidase 2 (ACER2)
Gene ID:
549870 (Xenopus tropicalis, ACER2)
Synonyms:
ACER2, acer2.S, acer2, Acer2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS108
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4030761
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Alkaline Ceramidase 2 (ACER2)
Gene ID:
549870 (Xenopus tropicalis, ACER2)
Synonyms:
ACER2, acer2.S, acer2, Acer2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS107
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T3 Promoter
Expression:
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4027201
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Alkaline Ceramidase 2 (ACER2)
Gene ID:
340485 (Human, ACER2)
Synonyms:
ACER2, acer2.S, acer2, Acer2
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3470658
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Alkaline Ceramidase 2 (ACER2)
Gene ID:
779231 (Xenopus laevis, ACER2)
Synonyms:
ACER2, acer2.S, acer2, Acer2
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4069408
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Alkaline Ceramidase 2 (ACER2)
Gene ID:
230379 (Mouse (Murine), ACER2)
Synonyms:
ACER2, acer2.S, acer2, Acer2
Vector type:
Cloning Vector
Vector backbone:
pYX-Asc
Resistance Gene:
Ampicillin
Promoter:
T3 Promoter

Sequencing Primer:
  • T7
  • T3
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4102677
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression
Gene:
Alkaline Ceramidase 2 (ACER2)
NCBI Accession:
NM_001290543,NP_001277472
Species:
Mouse (Murine)
Synonyms:
ACER2, acer2.S, acer2, Acer2
Insert length:
660 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3308519
$220.00
10 μg
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression
Gene:
Alkaline Ceramidase 2 (ACER2)
NCBI Accession:
NM_001290541,NP_001277470
Species:
Mouse (Murine)
Synonyms:
ACER2, acer2.S, acer2, Acer2
Insert length:
690 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3308520
$230.00
10 μg
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Alkaline Ceramidase 2 (ACER2)
NCBI Accession:
NM_139306
Species:
Mouse (Murine)
Synonyms:
ACER2, acer2.S, acer2, Acer2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948165

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3611657
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Alkaline Ceramidase 2 (ACER2)
NCBI Accession:
NM_139306
Species:
Mouse (Murine)
Synonyms:
ACER2, acer2.S, acer2, Acer2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948163

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3611656
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Alkaline Ceramidase 2 (ACER2)
NCBI Accession:
NM_139306
Species:
Mouse (Murine)
Synonyms:
ACER2, acer2.S, acer2, Acer2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-N-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948167

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3611662
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Alkaline Ceramidase 2 (ACER2)
NCBI Accession:
NM_139306
Species:
Mouse (Murine)
Synonyms:
ACER2, acer2.S, acer2, Acer2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-N-Myc
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
MYC tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948168

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3611664
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Alkaline Ceramidase 2 (ACER2)
NCBI Accession:
NM_139306
Species:
Mouse (Murine)
Synonyms:
ACER2, acer2.S, acer2, Acer2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-untagged
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable

Empty vector controls:
ABIN4948161

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3611666
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Alkaline Ceramidase 2 (ACER2)
NCBI Accession:
NM_139306
Species:
Mouse (Murine)
Synonyms:
ACER2, acer2.S, acer2, Acer2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948162

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3611654
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Alkaline Ceramidase 2 (ACER2)
NCBI Accession:
NM_139306
Species:
Mouse (Murine)
Synonyms:
ACER2, acer2.S, acer2, Acer2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-Myc
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
MYC tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948164

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3611658
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to ACER2

  • alkaline ceramidase 2 (ACER2)
  • alkaline ceramidase 2 S homeolog (acer2.S)
  • alkaline ceramidase 2 (acer2)
  • alkaline ceramidase 2 (Acer2)
  • 2410116I05Rik
  • ALKCDase2
  • ASAH3L
  • asah3l
  • Asah3l
  • CRG-L1
  • maCER2

Gene-IDs for different species

GENE IDSPECIES
481553 Canis lupus familiaris
779231 Xenopus laevis
100337862 Oryctolagus cuniculus
465015 Pan troglodytes
540732 Bos taurus
549870 Xenopus (Silurana) tropicalis
100528685 Ictalurus punctatus
340485 Homo sapiens
230379 Mus musculus
313339 Rattus norvegicus

Protein level used designations for ACER2

  • alkaline ceramidase 2
  • N-acylsphingosine amidohydrolase 3-like
  • putative protein, with at least 4 transmembrane domains, of eukaryotic origin (5H174)
  • alkCDase 2
  • alkaline CDase 2
  • ceramide hydrolase
  • haCER2
  • cancer related gene-liver 1 (CRG-L1)
  • cancer-related gene liver 1 protein
Other products related to ACER2 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com