ACIN1 (Apoptotic Chromatin Condensation Inducer 1, ACIN1)

Short Description: Apoptosis is defined by several morphologic nuclear changes, including chromatin condensation and nuclear fragmentation. This gene encodes a nuclear protein that induces apoptotic chromatin condensation after activation by caspase-3, without inducing DNA fragmentation. This protein has also been shown to be a component of a splicing-dependent multiprotein exon junction complex (EJC) that is deposited at splice junctions on mRNAs, as a consequence of pre-mRNA splicing. It may thus be involved in mRNA metabolism associated with splicing. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Oct 2011].
More information related to gene ACIN1.
Products related to ACIN1 Gene:
174 Products
Type
  • 170
  • 4
Species
  • 90
  • 59
  • 17
  • 2
  • 2
Application
  • 108
  • 50
  • 20
  • 16
Fusion tag
  • 48
  • 25
  • 24
  • 22
  • 8
Vector Backbone
  • 16
  • 14
  • 14
  • 8
  • 8
Vector
  • 72
  • 50
  • 32
  • 10
  • 6
Insert
  • 86
  • 52
  • 16
  • 8
  • 6
Oligo-Type
  • 4
Resistance Gene
  • 86
  • 44
  • 32
  • 8
  • 2
Expression Type
  • 168
  • 72
Selectable Marker
  • 60
  • 22
  • 2
Promoter
  • 78
  • 34
  • 26
  • 20
  • 8
Format
  • 72
  • 62
  • 26
  • 14
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Apoptotic Chromatin Condensation Inducer 1 (ACIN1)
Gene ID:
734979 (Xenopus laevis, ACIN1)
Synonyms:
acin1b, acin1a, acin1, ACIN1, acin1.S, Acin1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3984600
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Apoptotic Chromatin Condensation Inducer 1 (ACIN1)
Gene ID:
22985 (Human, ACIN1)
Synonyms:
acin1b, acin1a, acin1, ACIN1, acin1.S, Acin1
Vector type:
Cloning Vector
Vector backbone:
pCR-XL-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3996893
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Apoptotic Chromatin Condensation Inducer 1 (ACIN1)
Gene ID:
407918 (Xenopus tropicalis, ACIN1)
Synonyms:
acin1b, acin1a, acin1, ACIN1, acin1.S, Acin1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3882839
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Apoptotic Chromatin Condensation Inducer 1 (ACIN1)
Gene ID:
534600 (Cow (Bovine), ACIN1)
Synonyms:
acin1b, acin1a, acin1, ACIN1, acin1.S, Acin1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3862653
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Apoptotic Chromatin Condensation Inducer 1 (ACIN1)
Gene ID:
734979 (Xenopus laevis, ACIN1)
Synonyms:
acin1b, acin1a, acin1, ACIN1, acin1.S, Acin1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3984599
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Apoptotic Chromatin Condensation Inducer 1 (ACIN1)
Gene ID:
534600 (Cow (Bovine), ACIN1)
Synonyms:
acin1b, acin1a, acin1, ACIN1, acin1.S, Acin1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3862651
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Apoptotic Chromatin Condensation Inducer 1 (ACIN1)
Gene ID:
22985 (Human, ACIN1)
Synonyms:
acin1b, acin1a, acin1, ACIN1, acin1.S, Acin1
Vector type:
Cloning Vector
Vector backbone:
pCR-XL-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3996894
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Apoptotic Chromatin Condensation Inducer 1 (ACIN1)
Gene ID:
407918 (Xenopus tropicalis, ACIN1)
Synonyms:
acin1b, acin1a, acin1, ACIN1, acin1.S, Acin1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3882838
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Cloning
Gene:
Apoptotic Chromatin Condensation Inducer 1 (ACIN1)
NCBI Accession:
NM_014977
Species:
Human
Synonyms:
acin1b, acin1a, acin1, ACIN1, acin1.S, Acin1
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5720725
$375.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Apoptotic Chromatin Condensation Inducer 1 (ACIN1)
NCBI Accession:
NM_001164816,NP_001158288
Species:
Human
Synonyms:
acin1b, acin1a, acin1, ACIN1, acin1.S, Acin1
Insert length:
1845 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5337739
$410.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Apoptotic Chromatin Condensation Inducer 1 (ACIN1)
NCBI Accession:
NM_001164817,NP_001158289
Species:
Human
Synonyms:
acin1b, acin1a, acin1, ACIN1, acin1.S, Acin1
Insert length:
1752 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5337738
$410.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see

Application:
RNA Interference
Gene:
Apoptotic Chromatin Condensation Inducer 1
Species:
Human
Synonyms:
acinus, acinusb, fi14c05, wu:fe06a10, wu:fi14c05, acinusa, acinusl, ik:tdsubc_2g5, si:zc14a17.12, wu:fb04g06, wu:fb40f03, wu:fb68h03, wu:fb80f07, wu:fc12e10, xx:tdsubc_2g5, acn, ACINUS, ACN, fSAP152, 2610036I19Rik, 2610510L13Rik, Acinus, Acn, C79325, acinusL, acinusS, mKIAA0670
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • ACIN1 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3283954
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Apoptotic Chromatin Condensation Inducer 1 (ACIN1)
NCBI Accession:
NM_014977
Species:
Human
Synonyms:
acin1b, acin1a, acin1, ACIN1, acin1.S, Acin1
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ACIN1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5083480
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
Supplier: Log in to see

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Apoptotic Chromatin Condensation Inducer 1 (ACIN1)
NCBI Accession:
NM_019567
Species:
Mouse (Murine)
Synonyms:
acin1b, acin1a, acin1, ACIN1, acin1.S, Acin1
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Acin1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5083482
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
Supplier: Log in to see

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Apoptotic Chromatin Condensation Inducer 1 (ACIN1)
NCBI Accession:
NM_001170468
Species:
Rat (Rattus)
Synonyms:
acin1b, acin1a, acin1, ACIN1, acin1.S, Acin1
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Acin1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5083484
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
Supplier: Log in to see

Application:
RNA Interference
Gene:
Apoptotic Chromatin Condensation Inducer 1
Species:
Mouse (Murine)
Synonyms:
acinus, acinusb, fi14c05, wu:fe06a10, wu:fi14c05, acinusa, acinusl, ik:tdsubc_2g5, si:zc14a17.12, wu:fb04g06, wu:fb40f03, wu:fb68h03, wu:fb80f07, wu:fc12e10, xx:tdsubc_2g5, acn, ACINUS, ACN, fSAP152, 2610036I19Rik, 2610510L13Rik, Acinus, Acn, C79325, acinusL, acinusS, mKIAA0670
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Acin1 (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3265267
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Cloning
Gene:
Apoptotic Chromatin Condensation Inducer 1 (ACIN1)
NCBI Accession:
NM_001085472
Species:
Mouse (Murine)
Synonyms:
acin1b, acin1a, acin1, ACIN1, acin1.S, Acin1
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5720727
$475.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Cloning
Gene:
Apoptotic Chromatin Condensation Inducer 1 (ACIN1)
NCBI Accession:
NM_001242605
Species:
Mouse (Murine)
Synonyms:
acin1b, acin1a, acin1, ACIN1, acin1.S, Acin1
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5720730
$475.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Cloning
Gene:
Apoptotic Chromatin Condensation Inducer 1 (ACIN1)
NCBI Accession:
NM_001242606
Species:
Mouse (Murine)
Synonyms:
acin1b, acin1a, acin1, ACIN1, acin1.S, Acin1
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5720726
$475.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Cloning
Gene:
Apoptotic Chromatin Condensation Inducer 1 (ACIN1)
NCBI Accession:
NM_019567
Species:
Mouse (Murine)
Synonyms:
acin1b, acin1a, acin1, ACIN1, acin1.S, Acin1
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5720728
$475.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
  • <
  • 1

Synonyms and alternative names related to ACIN1

  • apoptotic chromatin condensation inducer 1b (acin1b)
  • apoptotic chromatin condensation inducer 1a (acin1a)
  • apoptotic chromatin condensation inducer 1 (acin1)
  • apoptotic chromatin condensation inducer 1 (ACIN1)
  • apoptotic chromatin condensation inducer 1 S homeolog (acin1.S)
  • apoptotic chromatin condensation inducer 1 (Acin1)
  • 2610036I19Rik
  • 2610510L13Rik
  • acinus
  • Acinus
  • ACINUS
  • acinusa
  • acinusb
  • acinusl
  • acinusL
  • acinusS
  • ACN
  • Acn
  • acn
  • C79325
  • fi14c05
  • fSAP152
  • ik:tdsubc_2g5
  • mKIAA0670
  • si:zc14a17.12
  • wu:fb04g06
  • wu:fb40f03
  • wu:fb68h03
  • wu:fb80f07
  • wu:fc12e10
  • wu:fe06a10
  • wu:fi14c05
  • xx:tdsubc_2g5

Gene-IDs for different species

GENE IDSPECIES
327495 Danio rerio
368893 Danio rerio
407918 Xenopus (Silurana) tropicalis
452792 Pan troglodytes
480247 Canis lupus familiaris
534600 Bos taurus
713310 Macaca mulatta
734979 Xenopus laevis
100338262 Oryctolagus cuniculus
100470890 Ailuropoda melanoleuca
100594211 Nomascus leucogenys
22985 Homo sapiens
56215 Mus musculus
305884 Rattus norvegicus

Protein level used designations for ACIN1

  • apoptotic chromatin condensation inducer in the nucleus, b
  • apoptotic chromatin condensation inducer in the nucleus, a
  • apoptotic chromatin condensation inducer 1
  • apoptotic chromatin condensation inducer in the nucleus
  • apoptotic chromatin condensation inducer in the nucleus-like
  • functional spliceosome-associated protein 152
  • acinus
Other products related to ACIN1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com