ACLY (ATP Citrate Lyase, ACLY)

Short Description: ATP citrate lyase is the primary enzyme responsible for the synthesis of cytosolic acetyl-CoA in many tissues. The enzyme is a tetramer (relative molecular weight approximately 440,000) of apparently identical subunits. It catalyzes the formation of acetyl-CoA and oxaloacetate from citrate and CoA with a concomitant hydrolysis of ATP to ADP and phosphate. The product, acetyl-CoA, serves several important biosynthetic pathways, including lipogenesis and cholesterogenesis. In nervous tissue, ATP citrate-lyase may be involved in the biosynthesis of acetylcholine. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008].
More information related to gene ACLY.
Products related to ACLY Gene:
135 Products
Data Quality
  • 2
Type
  • 129
  • 6
Species
  • 49
  • 39
  • 39
  • 2
  • 2
Oligo-Type
  • 6
Insert
  • 60
  • 38
  • 19
  • 6
  • 4
Vector
  • 53
  • 36
  • 20
  • 9
  • 9
Vector Backbone
  • 11
  • 9
  • 9
  • 5
  • 5
Fusion tag
  • 44
  • 20
  • 17
  • 15
  • 6
Resistance Gene
  • 57
  • 39
  • 26
  • 7
  • 2
Selectable Marker
  • 38
  • 22
  • 1
Promoter
  • 53
  • 27
  • 21
  • 19
  • 6
Expression Type
  • 123
  • 56
Application
  • 76
  • 40
  • 25
  • 12
Format
  • 52
  • 45
  • 19
  • 19
Supplier: Log in to see

ORF Cloning-Vector holds the gene between an AflII and EcoRV cut site.

Type:
ORF
Application:
Cloning
Gene:
ATP Citrate Lyase (ACLY)
Species:
Human
Synonyms:
ACLY, acly.S, LOC587157, acly, ATPCL, LOC5564509, CpipJ_CPIJ010291, Bm1_26245, ACL, Acly, aclya
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5734059
€39.82
1 μg
Plus shipping costs €45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Mammalian Vector with ORF clone of Human ATP citrate lyase (ACLY) transcript variant 1

Type:
ORF
Application:
Protein Expression
Gene:
ATP Citrate Lyase (ACLY)
NCBI Accession:
NM_001096,NP_001087
Species:
Human
Synonyms:
ACLY, acly.S, LOC587157, acly, ATPCL, LOC5564509, CpipJ_CPIJ010291, Bm1_26245, ACL, Acly, aclya
Insert length:
3306 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5380340
€86.73
10 μg
Plus shipping costs €45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see

Full length Danio rerio ATP citrate lyase a cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
ATP Citrate Lyase (ACLY)
Gene ID:
436922 (Zebrafish (Danio rerio), ACLY)
Synonyms:
ACLY, acly.S, LOC587157, acly, ATPCL, LOC5564509, CpipJ_CPIJ010291, Bm1_26245, ACL, Acly, aclya
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4057924
€87.61
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Xenopus laevis ATP citrate lyase cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
ATP Citrate Lyase (ACLY)
Gene ID:
495086 (Xenopus laevis, ACLY)
Synonyms:
ACLY, acly.S, LOC587157, acly, ATPCL, LOC5564509, CpipJ_CPIJ010291, Bm1_26245, ACL, Acly, aclya
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3853153
€97.35
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Xenopus tropicalis ATP citrate lyase cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
ATP Citrate Lyase (ACLY)
Gene ID:
493390 (Xenopus tropicalis, ACLY)
Synonyms:
ACLY, acly.S, LOC587157, acly, ATPCL, LOC5564509, CpipJ_CPIJ010291, Bm1_26245, ACL, Acly, aclya
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3885909
€97.35
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Rattus norvegicus ATP citrate lyase cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
ATP Citrate Lyase (ACLY)
Gene ID:
24159 (Rat (Rattus), ACLY)
Synonyms:
ACLY, acly.S, LOC587157, acly, ATPCL, LOC5564509, CpipJ_CPIJ010291, Bm1_26245, ACL, Acly, aclya
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3878828
€97.35
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Homo sapiens ATP citrate lyase cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
ATP Citrate Lyase (ACLY)
Gene ID:
47 (Human, ACLY)
Synonyms:
ACLY, acly.S, LOC587157, acly, ATPCL, LOC5564509, CpipJ_CPIJ010291, Bm1_26245, ACL, Acly, aclya
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4082978
€97.35
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Bos taurus ATP citrate lyase cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
ATP Citrate Lyase (ACLY)
Gene ID:
511135 (Cow (Bovine), ACLY)
Synonyms:
ACLY, acly.S, LOC587157, acly, ATPCL, LOC5564509, CpipJ_CPIJ010291, Bm1_26245, ACL, Acly, aclya
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4062271
€97.35
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Danio rerio ATP citrate lyase a cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
ATP Citrate Lyase (ACLY)
Gene ID:
436922 (Zebrafish (Danio rerio), ACLY)
Synonyms:
ACLY, acly.S, LOC587157, acly, ATPCL, LOC5564509, CpipJ_CPIJ010291, Bm1_26245, ACL, Acly, aclya
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4057925
€123.01
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Xenopus laevis ATP citrate lyase cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
ATP Citrate Lyase (ACLY)
Gene ID:
495086 (Xenopus laevis, ACLY)
Synonyms:
ACLY, acly.S, LOC587157, acly, ATPCL, LOC5564509, CpipJ_CPIJ010291, Bm1_26245, ACL, Acly, aclya
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3853152
€136.67
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Xenopus tropicalis ATP citrate lyase cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
ATP Citrate Lyase (ACLY)
Gene ID:
493390 (Xenopus tropicalis, ACLY)
Synonyms:
ACLY, acly.S, LOC587157, acly, ATPCL, LOC5564509, CpipJ_CPIJ010291, Bm1_26245, ACL, Acly, aclya
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3885908
€136.67
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Rattus norvegicus ATP citrate lyase cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
ATP Citrate Lyase (ACLY)
Gene ID:
24159 (Rat (Rattus), ACLY)
Synonyms:
ACLY, acly.S, LOC587157, acly, ATPCL, LOC5564509, CpipJ_CPIJ010291, Bm1_26245, ACL, Acly, aclya
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3878829
€136.67
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens ATP citrate lyase cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
ATP Citrate Lyase (ACLY)
Gene ID:
47 (Human, ACLY)
Synonyms:
ACLY, acly.S, LOC587157, acly, ATPCL, LOC5564509, CpipJ_CPIJ010291, Bm1_26245, ACL, Acly, aclya
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4082979
€136.67
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Bos taurus ATP citrate lyase cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
ATP Citrate Lyase (ACLY)
Gene ID:
511135 (Cow (Bovine), ACLY)
Synonyms:
ACLY, acly.S, LOC587157, acly, ATPCL, LOC5564509, CpipJ_CPIJ010291, Bm1_26245, ACL, Acly, aclya
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4062272
€136.67
1 vial
Plus shipping costs €45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human ACLY is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
ATP Citrate Lyase (ACLY)
NCBI Accession:
NM_001096,NP_001087
Species:
Human
Synonyms:
ACLY, acly.S, LOC587157, acly, ATPCL, LOC5564509, CpipJ_CPIJ010291, Bm1_26245, ACL, Acly, aclya
Insert length:
4780 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948183

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Migita, Okabe, Ikeda, Igarashi, Sugawara, Tomida, Soga, Taguchi, Seimiya: "Inhibition of ATP citrate lyase induces triglyceride accumulation with altered fatty acid composition in cancer cells." in: International journal of cancer, Vol. 135, Issue 1, pp. 37-47, 2014 (Pubmed)
  • Gao, Islam, Tian, Lui, Xiao: "Inactivation of ATP citrate lyase by Cucurbitacin B: A bioactive compound from cucumber, inhibits prostate cancer growth." in: Cancer letters, Vol. 349, Issue 1, pp. 15-25, 2014 (Pubmed)
Catalog No. ABIN3376884
€168.14
10 μg
Plus shipping costs €45.00
Delivery in 8 to 11 Business Days
Supplier: Log in to see

Entry clone of human cDNA (ORF) without STOP codon in Gateway pDONR223 Vector.

Type:
ORF
Application:
Cloning
Gene:
ATP Citrate Lyase (ACLY)
Gene ID:
47 (Human, ACLY)
Synonyms:
ACLY, acly.S, LOC587157, acly, ATPCL, LOC5564509, CpipJ_CPIJ010291, Bm1_26245, ACL, Acly, aclya
Insert length:
3306 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5318662
€198.88
2 μg
Plus shipping costs €45.00
Delivery in 15 to 17 Business Days
Supplier: Log in to see

Mammalian expression of Human ACLY with HA tag

Type:
cDNA
Application:
Protein Expression
Gene:
ATP Citrate Lyase (ACLY)
Species:
Human
Synonyms:
ACLY, acly.S, LOC587157, acly, ATPCL, LOC5564509, CpipJ_CPIJ010291, Bm1_26245, ACL, Acly, aclya
Insert length:
3306 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4471706
€243.36
500 ng
Plus shipping costs €45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Human ACLY with His-MBP

Type:
cDNA
Application:
Cloning
Gene:
ATP Citrate Lyase (ACLY)
Species:
Human
Synonyms:
ACLY, acly.S, LOC587157, acly, ATPCL, LOC5564509, CpipJ_CPIJ010291, Bm1_26245, ACL, Acly, aclya
Insert length:
3306 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4696874
€243.36
500 ng
Plus shipping costs €45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Human ACLY with His tag

Type:
cDNA
Application:
Cloning
Gene:
ATP Citrate Lyase (ACLY)
Species:
Human
Synonyms:
ACLY, acly.S, LOC587157, acly, ATPCL, LOC5564509, CpipJ_CPIJ010291, Bm1_26245, ACL, Acly, aclya
Insert length:
3306 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4758081
€243.36
500 ng
Plus shipping costs €45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Human ACLY with His-GST

Type:
cDNA
Application:
Cloning
Gene:
ATP Citrate Lyase (ACLY)
Species:
Human
Synonyms:
ACLY, acly.S, LOC587157, acly, ATPCL, LOC5564509, CpipJ_CPIJ010291, Bm1_26245, ACL, Acly, aclya
Insert length:
3306 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4826003
€243.36
500 ng
Plus shipping costs €45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to ACLY

  • ATP citrate lyase (ACLY)
  • ATP citrate lyase S homeolog (acly.S)
  • ATP-citrate synthase (LOC587157)
  • ATP citrate lyase (acly)
  • ATP citrate lyase (ATPCL)
  • ATP-citrate synthase (LOC5564509)
  • citrate synthase, mitochondrial (CpipJ_CPIJ010291)
  • ATP-citrate synthase (Bm1_26245)
  • atp-citrate synthase (ACL)
  • ATP citrate lyase (Acly)
  • ATP citrate lyase a (aclya)
  • A730098H14Rik
  • ACL
  • ACLY
  • acly
  • anon-WO0140519.179
  • ATPCL
  • AW538652
  • BcDNA:LD21334
  • cb722
  • CG8322
  • Clatp
  • CLATP
  • dATPCL
  • DDBDRAFT_0205389
  • DDBDRAFT_0235360
  • DDB_0205389
  • DDB_0235360
  • DmATPCL
  • Dmel\\CG8322
  • l(2)01466
  • l(2)k09217
  • n(2)k09217
  • zgc:92008

Gene-IDs for different species

GENE IDSPECIES
100053195 Equus caballus
454672 Pan troglodytes
495086 Xenopus laevis
587157 Strongylocentrotus purpuratus
708501 Macaca mulatta
8621508 Dictyostelium discoideum AX4
100405725 Callithrix jacchus
100422779 Felis catus
100439535 Pongo abelii
100467494 Ailuropoda melanoleuca
36760 Drosophila melanogaster
5564509 Aedes aegypti
6042632 Culex quinquefasciatus
6100149 Brugia malayi
7201075 Phaeodactylum tricornutum CCAP 1055/1
47 Homo sapiens
104112 Mus musculus
24159 Rattus norvegicus
100125957 Sus scrofa
511135 Bos taurus
395373 Gallus gallus
607852 Canis lupus familiaris
654404 Ovis aries
436922 Danio rerio

Protein level used designations for ACLY

  • ATP citrate lyase
  • ATP citrate synthase
  • ATP-citrate synthase-like
  • ATP-citrate lyase
  • ATPCL-PD
  • ATPCL-PE
  • ATPCL-PF
  • CG8322-PD
  • CG8322-PE
  • CG8322-PF
  • ATP-citrate synthase
  • citrate synthase, mitochondrial
  • atp-citrate synthase
  • ATP-citrate (pro-S-)-lyase
  • citrate cleavage enzyme
Other products related to ACLY such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com