ACMSD (Aminocarboxymuconate Semialdehyde Decarboxylase, ACMSD)

Short Description: The neuronal excitotoxin quinolinate is an intermediate in the de novo synthesis pathway of NAD from tryptophan, and has been implicated in the pathogenesis of several neurodegenerative disorders. Quinolinate is derived from alpha-amino-beta-carboxy-muconate-epsilon-semialdehyde (ACMS). ACMSD (ACMS decarboxylase\; EC can divert ACMS to a benign catabolite and thus prevent the accumulation of quinolinate from ACMS.[supplied by OMIM, Oct 2004].
More information related to gene ACMSD.
Products related to ACMSD Gene:
103 Products
  • 98
  • 5
  • 41
  • 30
  • 28
  • 2
  • 2
  • 51
  • 26
  • 26
  • 16
Fusion tag
  • 39
  • 16
  • 10
  • 9
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
  • 36
  • 30
  • 12
  • 9
  • 9
  • 38
  • 23
  • 21
  • 8
  • 6
  • 5
Resistance Gene
  • 36
  • 35
  • 22
  • 5
  • 2
Expression Type
  • 90
  • 51
Selectable Marker
  • 29
  • 26
  • 1
  • 32
  • 31
  • 13
  • 9
  • 8
  • 38
  • 27
  • 22
  • 16

Aminocarboxymuconate Semialdehyde Decarboxylase (ACMSD)
ACMSD, acmsd, acmsd.S, Acmsd
Insert length:
837 bp
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5731420
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Aminocarboxymuconate Semialdehyde Decarboxylase (ACMSD)
Gene ID:
130013 (Human, ACMSD)
ACMSD, acmsd, acmsd.S, Acmsd
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • M13(-21)
Glycerol Stock
-80 °C
Catalog No. ABIN4039698
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Aminocarboxymuconate Semialdehyde Decarboxylase (ACMSD)
Gene ID:
130013 (Human, ACMSD)
ACMSD, acmsd, acmsd.S, Acmsd
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • M13(-21)
Glycerol Stock
-80 °C
Catalog No. ABIN4039700
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Aminocarboxymuconate Semialdehyde Decarboxylase (ACMSD)
Gene ID:
515030 (Cow (Bovine), ACMSD)
ACMSD, acmsd, acmsd.S, Acmsd
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3859145
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Aminocarboxymuconate Semialdehyde Decarboxylase (ACMSD)
Gene ID:
266645 (Mouse (Murine), ACMSD)
ACMSD, acmsd, acmsd.S, Acmsd
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4015718
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Aminocarboxymuconate Semialdehyde Decarboxylase (ACMSD)
Gene ID:
130013 (Human, ACMSD)
ACMSD, acmsd, acmsd.S, Acmsd
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • M13(-21)
Glycerol Stock
-80 °C
Catalog No. ABIN4039697
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Aminocarboxymuconate Semialdehyde Decarboxylase (ACMSD)
Gene ID:
130013 (Human, ACMSD)
ACMSD, acmsd, acmsd.S, Acmsd
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • M13(-21)
Glycerol Stock
-80 °C
Catalog No. ABIN4039699
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Aminocarboxymuconate Semialdehyde Decarboxylase (ACMSD)
Gene ID:
515030 (Cow (Bovine), ACMSD)
ACMSD, acmsd, acmsd.S, Acmsd
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3859144
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Aminocarboxymuconate Semialdehyde Decarboxylase (ACMSD)
Gene ID:
266645 (Mouse (Murine), ACMSD)
ACMSD, acmsd, acmsd.S, Acmsd
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4015717
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Aminocarboxymuconate Semialdehyde Decarboxylase (ACMSD)
Gene ID:
130013 (Human, ACMSD)
ACMSD, acmsd, acmsd.S, Acmsd
Insert length:
837 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
2 μg of lyophilized gene in pDONR223 vector
-20 °C
Catalog No. ABIN5314269
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Aminocarboxymuconate Semialdehyde Decarboxylase (ACMSD)
ACMSD, acmsd, acmsd.S, Acmsd
Insert length:
837 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4372174
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Protein Expression
Aminocarboxymuconate Semialdehyde Decarboxylase (ACMSD)
ACMSD, acmsd, acmsd.S, Acmsd
Insert length:
837 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
His tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4432802
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Protein Expression
Aminocarboxymuconate Semialdehyde Decarboxylase (ACMSD)
ACMSD, acmsd, acmsd.S, Acmsd
Insert length:
837 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
HA tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4471707
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Aminocarboxymuconate Semialdehyde Decarboxylase (ACMSD)
ACMSD, acmsd, acmsd.S, Acmsd
Insert length:
837 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4696875
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Aminocarboxymuconate Semialdehyde Decarboxylase (ACMSD)
ACMSD, acmsd, acmsd.S, Acmsd
Insert length:
837 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4758082
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Aminocarboxymuconate Semialdehyde Decarboxylase (ACMSD)
ACMSD, acmsd, acmsd.S, Acmsd
Insert length:
837 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4826004
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Protein Expression
Aminocarboxymuconate Semialdehyde Decarboxylase (ACMSD)
Gene ID:
130013 (Human, ACMSD)
ACMSD, acmsd, acmsd.S, Acmsd
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3410548
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression
Aminocarboxymuconate Semialdehyde Decarboxylase (ACMSD)
NCBI Accession:
ACMSD, acmsd, acmsd.S, Acmsd
Insert length:
1337 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
Catalog No. ABIN3388061
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Protein Expression
Aminocarboxymuconate Semialdehyde Decarboxylase (ACMSD)
NCBI Accession:
Mouse (Murine)
ACMSD, acmsd, acmsd.S, Acmsd
Insert length:
1011 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
Catalog No. ABIN3308545
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Protein Expression
Aminocarboxymuconate Semialdehyde Decarboxylase (ACMSD)
NCBI Accession:
Rat (Rattus)
ACMSD, acmsd, acmsd.S, Acmsd
Insert length:
1011 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
Catalog No. ABIN3308546
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days
  • <
  • 1

Synonyms and alternative names related to ACMSD

  • aminocarboxymuconate semialdehyde decarboxylase (ACMSD)
  • aminocarboxymuconate semialdehyde decarboxylase (acmsd)
  • aminocarboxymuconate semialdehyde decarboxylase S homeolog (acmsd.S)
  • amino carboxymuconate semialdehyde decarboxylase (Acmsd)
  • aminocarboxymuconate semialdehyde decarboxylase (Acmsd)
  • zgc:162888

Gene-IDs for different species

424288 Gallus gallus
557166 Danio rerio
733325 Xenopus laevis
459627 Pan troglodytes
476125 Canis lupus familiaris
708917 Macaca mulatta
100413800 Callithrix jacchus
100446661 Pongo abelii
100483355 Ailuropoda melanoleuca
100528249 Ictalurus punctatus
100154768 Sus scrofa
266645 Mus musculus
130013 Homo sapiens
171385 Rattus norvegicus
515030 Bos taurus

Protein level used designations for ACMSD

  • aminocarboxymuconate semialdehyde decarboxylase
  • 2-amino-3-carboxylmuconate-6-semialdehyde decarboxylase
  • 2-amino-3-carboxymuconate-6-semialdehyde decarboxylase
  • 2-amino-3-carboxymuconate-6-semialdehyde decarboxylase-like
  • picolinate carboxylase
Other products related to ACMSD such as antibodies, ELISA kits and high-purity proteins are available on our partner website