ACMSD (Aminocarboxymuconate Semialdehyde Decarboxylase, ACMSD)

Short Description: The neuronal excitotoxin quinolinate is an intermediate in the de novo synthesis pathway of NAD from tryptophan, and has been implicated in the pathogenesis of several neurodegenerative disorders. Quinolinate is derived from alpha-amino-beta-carboxy-muconate-epsilon-semialdehyde (ACMS). ACMSD (ACMS decarboxylase\; EC 4.1.1.45) can divert ACMS to a benign catabolite and thus prevent the accumulation of quinolinate from ACMS.[supplied by OMIM, Oct 2004].
More information related to gene ACMSD.
Products related to ACMSD Gene:
103 Products
Type
  • 98
  • 5
Species
  • 41
  • 30
  • 28
  • 2
  • 2
Application
  • 51
  • 26
  • 26
  • 16
Fusion tag
  • 39
  • 16
  • 10
  • 9
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
Vector
  • 36
  • 30
  • 12
  • 9
  • 9
Insert
  • 38
  • 23
  • 21
  • 8
  • 6
Oligo-Type
  • 5
Resistance Gene
  • 36
  • 35
  • 22
  • 5
  • 2
Expression Type
  • 90
  • 51
Selectable Marker
  • 29
  • 26
  • 1
Promoter
  • 32
  • 31
  • 13
  • 9
  • 8
Format
  • 38
  • 27
  • 22
  • 16
Supplier: Log in to see

ORF Cloning-Vector holds the gene between an AflII and EcoRV cut site.

Type:
ORF
Application:
Cloning
Gene:
Aminocarboxymuconate Semialdehyde Decarboxylase (ACMSD)
Species:
Human
Synonyms:
ACMSD, acmsd, acmsd.S, Acmsd
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5731420
$70.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Full length Homo sapiens aminocarboxymuconate semialdehyde decarboxylase cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Aminocarboxymuconate Semialdehyde Decarboxylase (ACMSD)
Gene ID:
130013 (Human, ACMSD)
Synonyms:
ACMSD, acmsd, acmsd.S, Acmsd
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4039700
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Homo sapiens aminocarboxymuconate semialdehyde decarboxylase cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Aminocarboxymuconate Semialdehyde Decarboxylase (ACMSD)
Gene ID:
130013 (Human, ACMSD)
Synonyms:
ACMSD, acmsd, acmsd.S, Acmsd
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4039698
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Mus musculus amino carboxymuconate semialdehyde decarboxylase cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Aminocarboxymuconate Semialdehyde Decarboxylase (ACMSD)
Gene ID:
266645 (Mouse (Murine), ACMSD)
Synonyms:
ACMSD, acmsd, acmsd.S, Acmsd
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4015718
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Bos taurus aminocarboxymuconate semialdehyde decarboxylase cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Aminocarboxymuconate Semialdehyde Decarboxylase (ACMSD)
Gene ID:
515030 (Cow (Bovine), ACMSD)
Synonyms:
ACMSD, acmsd, acmsd.S, Acmsd
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3859145
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens aminocarboxymuconate semialdehyde decarboxylase cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Aminocarboxymuconate Semialdehyde Decarboxylase (ACMSD)
Gene ID:
130013 (Human, ACMSD)
Synonyms:
ACMSD, acmsd, acmsd.S, Acmsd
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4039699
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens aminocarboxymuconate semialdehyde decarboxylase cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Aminocarboxymuconate Semialdehyde Decarboxylase (ACMSD)
Gene ID:
130013 (Human, ACMSD)
Synonyms:
ACMSD, acmsd, acmsd.S, Acmsd
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4039697
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Mus musculus amino carboxymuconate semialdehyde decarboxylase cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Aminocarboxymuconate Semialdehyde Decarboxylase (ACMSD)
Gene ID:
266645 (Mouse (Murine), ACMSD)
Synonyms:
ACMSD, acmsd, acmsd.S, Acmsd
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4015717
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Bos taurus aminocarboxymuconate semialdehyde decarboxylase cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Aminocarboxymuconate Semialdehyde Decarboxylase (ACMSD)
Gene ID:
515030 (Cow (Bovine), ACMSD)
Synonyms:
ACMSD, acmsd, acmsd.S, Acmsd
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3859144
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Entry clone of human cDNA (ORF) without STOP codon in Gateway pDONR223 Vector.

Type:
ORF
Application:
Cloning
Gene:
Aminocarboxymuconate Semialdehyde Decarboxylase (ACMSD)
Gene ID:
130013 (Human, ACMSD)
Synonyms:
ACMSD, acmsd, acmsd.S, Acmsd
Insert length:
837 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5314269
$194.53
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
Supplier: Log in to see

Bacterial expression of Human ACMSD with His tag

Type:
cDNA
Application:
Cloning
Gene:
Aminocarboxymuconate Semialdehyde Decarboxylase (ACMSD)
Species:
Human
Synonyms:
ACMSD, acmsd, acmsd.S, Acmsd
Insert length:
837 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4372174
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Mammalian expression of Human ACMSD with His tag

Type:
cDNA
Application:
Protein Expression
Gene:
Aminocarboxymuconate Semialdehyde Decarboxylase (ACMSD)
Species:
Human
Synonyms:
ACMSD, acmsd, acmsd.S, Acmsd
Insert length:
837 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4432802
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Mammalian expression of Human ACMSD with HA tag

Type:
cDNA
Application:
Protein Expression
Gene:
Aminocarboxymuconate Semialdehyde Decarboxylase (ACMSD)
Species:
Human
Synonyms:
ACMSD, acmsd, acmsd.S, Acmsd
Insert length:
837 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4471707
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Human ACMSD with His-GST

Type:
cDNA
Application:
Cloning
Gene:
Aminocarboxymuconate Semialdehyde Decarboxylase (ACMSD)
Species:
Human
Synonyms:
ACMSD, acmsd, acmsd.S, Acmsd
Insert length:
837 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4826004
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Human ACMSD with His tag

Type:
cDNA
Application:
Cloning
Gene:
Aminocarboxymuconate Semialdehyde Decarboxylase (ACMSD)
Species:
Human
Synonyms:
ACMSD, acmsd, acmsd.S, Acmsd
Insert length:
837 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4758082
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Bacterial expression of Human ACMSD with His-MBP

Type:
cDNA
Application:
Cloning
Gene:
Aminocarboxymuconate Semialdehyde Decarboxylase (ACMSD)
Species:
Human
Synonyms:
ACMSD, acmsd, acmsd.S, Acmsd
Insert length:
837 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4696875
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

The aminocarboxymuconate semialdehyde decarboxylase ORF clone is provided in a Gateway adapted entry vector for fast and convenient transfer to any compatible expression vector.

Type:
ORF
Application:
Protein Expression
Gene:
Aminocarboxymuconate Semialdehyde Decarboxylase (ACMSD)
Gene ID:
130013 (Human, ACMSD)
Synonyms:
ACMSD, acmsd, acmsd.S, Acmsd
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3410548
$300.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human ACMSD is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Aminocarboxymuconate Semialdehyde Decarboxylase (ACMSD)
NCBI Accession:
NM_138326,NP_612199
Species:
Human
Synonyms:
ACMSD, acmsd, acmsd.S, Acmsd
Insert length:
1337 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3388061
$300.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days
Supplier: Log in to see

Mammalian Vector with ORF clone of Rat aminocarboxymuconate semialdehyde decarboxylase (Acmsd)

Type:
ORF
Application:
Protein Expression
Gene:
Aminocarboxymuconate Semialdehyde Decarboxylase (ACMSD)
NCBI Accession:
NM_134372,NP_599199
Species:
Rat (Rattus)
Synonyms:
ACMSD, acmsd, acmsd.S, Acmsd
Insert length:
1011 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5372034
$410.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Rat Acmsd is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Aminocarboxymuconate Semialdehyde Decarboxylase (ACMSD)
NCBI Accession:
NM_134372,NP_599199
Species:
Rat (Rattus)
Synonyms:
ACMSD, acmsd, acmsd.S, Acmsd
Insert length:
1011 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3308546
$410.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days
  • <
  • 1

Synonyms and alternative names related to ACMSD

  • aminocarboxymuconate semialdehyde decarboxylase (ACMSD)
  • aminocarboxymuconate semialdehyde decarboxylase (acmsd)
  • aminocarboxymuconate semialdehyde decarboxylase S homeolog (acmsd.S)
  • amino carboxymuconate semialdehyde decarboxylase (Acmsd)
  • aminocarboxymuconate semialdehyde decarboxylase (Acmsd)
  • ACMSD
  • zgc:162888

Gene-IDs for different species

GENE IDSPECIES
424288 Gallus gallus
557166 Danio rerio
733325 Xenopus laevis
459627 Pan troglodytes
476125 Canis lupus familiaris
708917 Macaca mulatta
100413800 Callithrix jacchus
100446661 Pongo abelii
100483355 Ailuropoda melanoleuca
100528249 Ictalurus punctatus
100154768 Sus scrofa
266645 Mus musculus
130013 Homo sapiens
171385 Rattus norvegicus
515030 Bos taurus

Protein level used designations for ACMSD

  • aminocarboxymuconate semialdehyde decarboxylase
  • 2-amino-3-carboxylmuconate-6-semialdehyde decarboxylase
  • 2-amino-3-carboxymuconate-6-semialdehyde decarboxylase
  • 2-amino-3-carboxymuconate-6-semialdehyde decarboxylase-like
  • picolinate carboxylase
Other products related to ACMSD such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com