ADK (Adenosine Kinase, ADK)

Short Description: This gene an enzyme which catalyzes the transfer of the gamma-phosphate from ATP to adenosine, thereby serving as a regulator of concentrations of both extracellular adenosine and intracellular adenine nucleotides. Adenosine has widespread effects on the cardiovascular, nervous, respiratory, and immune systems and inhibitors of the enzyme could play an important pharmacological role in increasing intravascular adenosine concentrations and acting as anti-inflammatory agents. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2011].
More information related to gene ADK.
Products related to ADK Gene:
175 Products
Data Quality
  • 1
Type
  • 166
  • 9
Species
  • 65
  • 55
  • 45
  • 6
  • 2
Application
  • 111
  • 40
  • 27
  • 16
  • 3
Fusion tag
  • 58
  • 20
  • 18
  • 14
  • 10
Vector Backbone
  • 8
  • 8
  • 7
  • 7
  • 6
Vector
  • 88
  • 37
  • 16
  • 12
  • 9
Insert
  • 73
  • 56
  • 21
  • 8
  • 6
Oligo-Type
  • 6
  • 3
Resistance Gene
  • 84
  • 55
  • 22
  • 5
  • 2
Expression Type
  • 115
  • 59
  • 39
Selectable Marker
  • 40
  • 39
  • 26
Promoter
  • 56
  • 46
  • 31
  • 18
  • 8
Format
  • 95
  • 36
  • 22
  • 22

Type:
ORF
Application:
Cloning
Gene:
Adenosine Kinase (ADK)
Species:
Human
Synonyms:
ADK, adk, Adk, CNN02130, LOC5572668, CMU_026370, adk.S
Insert length:
1038 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5720165
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Adenosine Kinase (ADK)
NCBI Accession:
NM_001123,NP_001114
Species:
Human
Synonyms:
ADK, adk, Adk, CNN02130, LOC5572668, CMU_026370, adk.S
Insert length:
1038 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5335041
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
Adenosine Kinase (ADK)
NCBI Accession:
NM_001123
Gene ID:
132 (Human, ADK)
Synonyms:
ADK, adk, Adk, CNN02130, LOC5572668, CMU_026370, adk.S
Insert length:
1038 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4933529
$99.00
10 μg
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Adenosine Kinase (ADK)
Gene ID:
11534 (Mouse (Murine), ADK)
Synonyms:
ADK, adk, Adk, CNN02130, LOC5572668, CMU_026370, adk.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3463363
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Adenosine Kinase (ADK)
Gene ID:
783572 (Cow (Bovine), ADK)
Synonyms:
ADK, adk, Adk, CNN02130, LOC5572668, CMU_026370, adk.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3871014
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Adenosine Kinase (ADK)
Gene ID:
444786 (Xenopus laevis, ADK)
Synonyms:
ADK, adk, Adk, CNN02130, LOC5572668, CMU_026370, adk.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3850722
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Adenosine Kinase (ADK)
Gene ID:
549452 (Xenopus tropicalis, ADK)
Synonyms:
ADK, adk, Adk, CNN02130, LOC5572668, CMU_026370, adk.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3865040
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Adenosine Kinase (ADK)
Gene ID:
549452 (Xenopus tropicalis, ADK)
Synonyms:
ADK, adk, Adk, CNN02130, LOC5572668, CMU_026370, adk.S
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4022506
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Adenosine Kinase (ADK)
Gene ID:
549452 (Xenopus tropicalis, ADK)
Synonyms:
ADK, adk, Adk, CNN02130, LOC5572668, CMU_026370, adk.S
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4022507
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Adenosine Kinase (ADK)
Gene ID:
25368 (Rat (Rattus), ADK)
Synonyms:
ADK, adk, Adk, CNN02130, LOC5572668, CMU_026370, adk.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4045804
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Adenosine Kinase (ADK)
Gene ID:
132 (Human, ADK)
Synonyms:
ADK, adk, Adk, CNN02130, LOC5572668, CMU_026370, adk.S
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4083051
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Adenosine Kinase (ADK)
Species:
Human
Synonyms:
ADK, adk, Adk, CNN02130, LOC5572668, CMU_026370, adk.S
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3555964
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Adenosine Kinase (ADK)
NCBI Accession:
NM_001243041
Species:
Mouse (Murine)
Synonyms:
ADK, adk, Adk, CNN02130, LOC5572668, CMU_026370, adk.S
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3614026
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Adenosine Kinase (ADK)
NCBI Accession:
NM_012895
Species:
Rat (Rattus)
Synonyms:
ADK, adk, Adk, CNN02130, LOC5572668, CMU_026370, adk.S
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3614027
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Adenosine Kinase
Species:
Mouse (Murine)
Synonyms:
AK, ADK, DDBDRAFT_0186795, DDBDRAFT_0230174, DDB_0186795, DDB_0230174, ATPADK1, F3G5.4, F3G5_4, adenosine kinase, adk, 2310026J05Rik, 5033405D03Rik, AI255373, AI987814, Ak
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3195011
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
Adenosine Kinase
Species:
Rat (Rattus)
Synonyms:
AK, ADK, DDBDRAFT_0186795, DDBDRAFT_0230174, DDB_0186795, DDB_0230174, ATPADK1, F3G5.4, F3G5_4, adenosine kinase, adk, 2310026J05Rik, 5033405D03Rik, AI255373, AI987814, Ak
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3196790
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
Adenosine Kinase
Species:
Human
Synonyms:
AK, ADK, DDBDRAFT_0186795, DDBDRAFT_0230174, DDB_0186795, DDB_0230174, ATPADK1, F3G5.4, F3G5_4, adenosine kinase, adk, 2310026J05Rik, 5033405D03Rik, AI255373, AI987814, Ak
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3190869
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Adenosine Kinase (ADK)
Gene ID:
11534 (Mouse (Murine), ADK)
Synonyms:
ADK, adk, Adk, CNN02130, LOC5572668, CMU_026370, adk.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3466792
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Adenosine Kinase (ADK)
Gene ID:
783572 (Cow (Bovine), ADK)
Synonyms:
ADK, adk, Adk, CNN02130, LOC5572668, CMU_026370, adk.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3871012
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Adenosine Kinase (ADK)
Gene ID:
444786 (Xenopus laevis, ADK)
Synonyms:
ADK, adk, Adk, CNN02130, LOC5572668, CMU_026370, adk.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3850723
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
  • <
  • 1

Synonyms and alternative names related to ADK

  • adenosine kinase (ADK)
  • adenosine kinase (adk)
  • ATP:adenosine 5'-phosphotransferase (adk)
  • Adenosine kinase (adk)
  • adenosine kinase (Adk)
  • adenosine kinase (CNN02130)
  • adenosine kinase (LOC5572668)
  • adenosine kinase (CMU_026370)
  • adenosine kinase S homeolog (adk.S)
  • 2310026J05Rik
  • 5033405D03Rik
  • adenosine kinase
  • ADK
  • adk
  • AI255373
  • AI987814
  • AK
  • Ak
  • ATPADK1
  • DDBDRAFT_0186795
  • DDBDRAFT_0230174
  • DDB_0186795
  • DDB_0230174
  • F3G5.4
  • F3G5_4

Gene-IDs for different species

GENE IDSPECIES
132 Homo sapiens
100072901 Equus caballus
6360172 Burkholderia multivorans ATCC 17616
705246 Macaca mulatta
8625430 Dictyostelium discoideum AX4
818302 Arabidopsis thaliana
450902 Pan troglodytes
423735 Gallus gallus
100306762 Salmo salar
479253 Canis lupus familiaris
549452 Xenopus (Silurana) tropicalis
783572 Bos taurus
11534 Mus musculus
25368 Rattus norvegicus
3255448 Cryptococcus neoformans var. neoformans JEC21
5572668 Aedes aegypti
6995067 Cryptosporidium muris RN66
100408817 Callithrix jacchus
100460175 Pongo abelii
100154626 Sus scrofa
100583963 Nomascus leucogenys
100736551 Cricetulus griseus
444786 Xenopus laevis

Protein level used designations for ADK

  • adenosine 5'-phosphotransferase
  • adenosine kinase (short isoform)-like protein
  • adenosine kinase
  • Adenosine kinase
  • adenosine kinase-like
  • Adenosine 5'-phosphotransferase
  • adenosine kinase S homeolog
Other products related to ADK such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com