aHSP (alpha Hemoglobin Stabilizing Protein, aHSP)

Short Description: Act as a chaperone to prevent the harmful aggregation of alpha-hemoglobin during normal erythroid cell development. Specifically protects free alpha-hemoglobin from precipitation (By similarity).
More information related to gene aHSP.
Products related to aHSP Gene:
113 Products
Type
  • 107
  • 6
Species
  • 55
  • 28
  • 28
  • 2
Application
  • 68
  • 23
  • 23
  • 20
  • 1
Fusion tag
  • 45
  • 15
  • 11
  • 10
  • 6
Vector Backbone
  • 8
  • 8
  • 6
  • 6
  • 4
Vector
  • 40
  • 38
  • 10
  • 9
  • 5
Insert
  • 37
  • 32
  • 18
  • 10
  • 8
Oligo-Type
  • 5
  • 1
Resistance Gene
  • 45
  • 39
  • 18
  • 5
  • 2
Expression Type
  • 87
  • 49
  • 13
Selectable Marker
  • 26
  • 24
  • 13
  • 2
  • 1
Promoter
  • 34
  • 28
  • 25
  • 11
  • 10
Format
  • 50
  • 25
  • 23
  • 15

Type:
ORF
Application:
Protein Expression
Gene:
alpha Hemoglobin Stabilizing Protein (aHSP)
NCBI Accession:
NM_016633,NP_057717
Species:
Human
Synonyms:
AHSP, Ahsp, LOC100620111
Insert length:
309 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5438490
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
alpha Hemoglobin Stabilizing Protein (aHSP)
Gene ID:
51327 (Human, aHSP)
Synonyms:
AHSP, Ahsp, LOC100620111
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3814409
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
alpha Hemoglobin Stabilizing Protein (aHSP)
Gene ID:
338381 (Cow (Bovine), aHSP)
Synonyms:
AHSP, Ahsp, LOC100620111
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3841296
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
alpha Hemoglobin Stabilizing Protein (aHSP)
Gene ID:
170812 (Mouse (Murine), aHSP)
Synonyms:
AHSP, Ahsp, LOC100620111
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3462252
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
alpha Hemoglobin Stabilizing Protein (aHSP)
Gene ID:
293522 (Rat (Rattus), aHSP)
Synonyms:
AHSP, Ahsp, LOC100620111
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4050428
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
alpha Hemoglobin Stabilizing Protein (aHSP)
Species:
Human
Synonyms:
AHSP, Ahsp, LOC100620111
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3556024
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
alpha Hemoglobin Stabilizing Protein
Species:
Human
Synonyms:
AHSP, ERAF, EDRF, Eraf
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3191375
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
ORF
Application:
Cloning
Gene:
alpha Hemoglobin Stabilizing Protein (aHSP)
Species:
Human
Synonyms:
AHSP, Ahsp, LOC100620111
Insert length:
309 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5751790
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
alpha Hemoglobin Stabilizing Protein (aHSP)
Gene ID:
51327 (Human, aHSP)
Synonyms:
AHSP, Ahsp, LOC100620111
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3814410
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
alpha Hemoglobin Stabilizing Protein (aHSP)
Gene ID:
338381 (Cow (Bovine), aHSP)
Synonyms:
AHSP, Ahsp, LOC100620111
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3841297
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
alpha Hemoglobin Stabilizing Protein (aHSP)
Gene ID:
293522 (Rat (Rattus), aHSP)
Synonyms:
AHSP, Ahsp, LOC100620111
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4050427
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
alpha Hemoglobin Stabilizing Protein (aHSP)
Gene ID:
170812 (Mouse (Murine), aHSP)
Synonyms:
AHSP, Ahsp, LOC100620111
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3992820
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
alpha Hemoglobin Stabilizing Protein (aHSP)
Gene ID:
51327 (Human, aHSP)
Synonyms:
AHSP, Ahsp, LOC100620111
Insert length:
309 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5314288
$184.46
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
alpha Hemoglobin Stabilizing Protein (aHSP)
NCBI Accession:
NM_016633,NP_057717
Species:
Human
Synonyms:
AHSP, Ahsp, LOC100620111
Insert length:
540 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948183

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3376964
$300.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
alpha Hemoglobin Stabilizing Protein (aHSP)
Species:
Human
Synonyms:
AHSP, Ahsp, LOC100620111
Insert length:
309 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4766895
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
alpha Hemoglobin Stabilizing Protein (aHSP)
Species:
Human
Synonyms:
AHSP, Ahsp, LOC100620111
Insert length:
309 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4761602
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
alpha Hemoglobin Stabilizing Protein (aHSP)
Species:
Human
Synonyms:
AHSP, Ahsp, LOC100620111
Insert length:
309 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4436322
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
alpha Hemoglobin Stabilizing Protein (aHSP)
Species:
Human
Synonyms:
AHSP, Ahsp, LOC100620111
Insert length:
309 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4475227
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
alpha Hemoglobin Stabilizing Protein (aHSP)
Gene ID:
51327 (Human, aHSP)
Synonyms:
AHSP, Ahsp, LOC100620111
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3397227
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
alpha Hemoglobin Stabilizing Protein (aHSP)
Gene ID:
51327 (Human, aHSP)
Synonyms:
AHSP, Ahsp, LOC100620111
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR221
Resistance Gene:
Kanamycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3418764
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
  • <
  • 1

Synonyms and alternative names related to aHSP

  • alpha hemoglobin stabilizing protein (AHSP)
  • alpha hemoglobin stabilizing protein (Ahsp)
  • alpha-hemoglobin-stabilizing protein-like (LOC100620111)
  • AHSP
  • EDRF
  • ERAF
  • Eraf

Gene-IDs for different species

GENE IDSPECIES
454073 Pan troglodytes
714392 Macaca mulatta
100127218 Ovis aries
100340962 Oryctolagus cuniculus
51327 Homo sapiens
170812 Mus musculus
338381 Bos taurus
293522 Rattus norvegicus
100712877 Cavia porcellus
100620111 Sus scrofa

Protein level used designations for aHSP

  • alpha hemoglobin stabilizing protein
  • erythroid associated factor
  • alpha hemoglobin stabilising protein
  • alpha-hemoglobin-stabilizing protein
  • erythroid differentiation associated factor
  • erythroid differentiation-related factor
  • erythroid-associated factor
Other products related to aHSP such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com