alpha 2 Macroglobulin (alpha-2-Macroglobulin, A2M)

Short Description: Alpha-2-macroglobulin is a protease inhibitor and cytokine transporter. It inhibits many proteases, including trypsin, thrombin and collagenase. A2M is implicated in Alzheimer disease (AD) due to its ability to mediate the clearance and degradation of A-beta, the major component of beta-amyloid deposits. [provided by RefSeq, Jul 2008].
More information related to gene alpha 2 Macroglobulin.
Products related to alpha 2 Macroglobulin Gene:
104 Products
Type
  • 97
  • 7
Species
  • 49
  • 27
  • 26
  • 2
Application
  • 54
  • 27
  • 24
  • 16
  • 1
Fusion tag
  • 38
  • 13
  • 11
  • 8
  • 7
Vector Backbone
  • 6
  • 6
  • 6
  • 4
  • 3
Vector
  • 40
  • 29
  • 12
  • 9
  • 5
Insert
  • 35
  • 25
  • 21
  • 8
  • 6
Oligo-Type
  • 6
  • 1
Resistance Gene
  • 43
  • 38
  • 12
  • 4
  • 2
Expression Type
  • 82
  • 49
  • 11
Selectable Marker
  • 26
  • 24
  • 11
Promoter
  • 31
  • 25
  • 21
  • 13
  • 8
Format
  • 44
  • 27
  • 20
  • 13

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
alpha-2-Macroglobulin (A2M)
Gene ID:
513856 (Cow (Bovine), A2M)
Synonyms:
A2M, A2m, LOC477699, pzp.L, AZL_c00450, LOC100349077, a2m, LOC100061656, LOC100090399, a2m.S, LOC100469973, LOC100595735, PZP, LOC100353095, LOC101122940, LOC101801552, LOC100911545
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3858603
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
alpha-2-Macroglobulin (A2M)
Gene ID:
2 (Human, A2M)
Synonyms:
A2M, A2m, LOC477699, pzp.L, AZL_c00450, LOC100349077, a2m, LOC100061656, LOC100090399, a2m.S, LOC100469973, LOC100595735, PZP, LOC100353095, LOC101122940, LOC101801552, LOC100911545
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3803075
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
alpha-2-Macroglobulin (A2M)
Gene ID:
24153 (Rat (Rattus), A2M)
Synonyms:
A2M, A2m, LOC477699, pzp.L, AZL_c00450, LOC100349077, a2m, LOC100061656, LOC100090399, a2m.S, LOC100469973, LOC100595735, PZP, LOC100353095, LOC101122940, LOC101801552, LOC100911545
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4045231
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
alpha-2-Macroglobulin (A2M)
NCBI Accession:
NM_000014
Species:
Human
Synonyms:
A2M, A2m, LOC477699, pzp.L, AZL_c00450, LOC100349077, a2m, LOC100061656, LOC100090399, a2m.S, LOC100469973, LOC100595735, PZP, LOC100353095, LOC101122940, LOC101801552, LOC100911545
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3610003
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
alpha-2-Macroglobulin
Species:
Human
Synonyms:
A2MD, CPAMD5, FWP007, S863-7, A2MAC1, A2m1, A2maa, Mam, A2mp, A2M, LOC733429, endod, cpamd5, fwp007, s863-7, a2mb, endodermin, Alpha-2-M
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3189164
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
alpha-2-Macroglobulin (A2M)
Gene ID:
513856 (Cow (Bovine), A2M)
Synonyms:
A2M, A2m, LOC477699, pzp.L, AZL_c00450, LOC100349077, a2m, LOC100061656, LOC100090399, a2m.S, LOC100469973, LOC100595735, PZP, LOC100353095, LOC101122940, LOC101801552, LOC100911545
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3858602
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
alpha-2-Macroglobulin (A2M)
Gene ID:
2 (Human, A2M)
Synonyms:
A2M, A2m, LOC477699, pzp.L, AZL_c00450, LOC100349077, a2m, LOC100061656, LOC100090399, a2m.S, LOC100469973, LOC100595735, PZP, LOC100353095, LOC101122940, LOC101801552, LOC100911545
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3803076
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
alpha-2-Macroglobulin (A2M)
Gene ID:
24153 (Rat (Rattus), A2M)
Synonyms:
A2M, A2m, LOC477699, pzp.L, AZL_c00450, LOC100349077, a2m, LOC100061656, LOC100090399, a2m.S, LOC100469973, LOC100595735, PZP, LOC100353095, LOC101122940, LOC101801552, LOC100911545
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4045232
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
alpha-2-Macroglobulin (A2M)
NCBI Accession:
NM_000014,NP_000005
Species:
Human
Synonyms:
A2M, A2m, LOC477699, pzp.L, AZL_c00450, LOC100349077, a2m, LOC100061656, LOC100090399, a2m.S, LOC100469973, LOC100595735, PZP, LOC100353095, LOC101122940, LOC101801552, LOC100911545
Insert length:
5150 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948184

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3382300
$300.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
alpha-2-Macroglobulin (A2M)
Gene ID:
2 (Human, A2M)
Synonyms:
A2M, A2m, LOC477699, pzp.L, AZL_c00450, LOC100349077, a2m, LOC100061656, LOC100090399, a2m.S, LOC100469973, LOC100595735, PZP, LOC100353095, LOC101122940, LOC101801552, LOC100911545
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3412158
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Application:
RNA Interference
Gene:
alpha-2-Macroglobulin
Species:
Mouse (Murine)
Synonyms:
A2MD, CPAMD5, FWP007, S863-7, A2MAC1, A2m1, A2maa, Mam, A2mp, A2M, LOC733429, endod, cpamd5, fwp007, s863-7, a2mb, endodermin, Alpha-2-M
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • A2m (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3349752
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
alpha-2-Macroglobulin
Species:
Rat (Rattus)
Synonyms:
A2MD, CPAMD5, FWP007, S863-7, A2MAC1, A2m1, A2maa, Mam, A2mp, A2M, LOC733429, endod, cpamd5, fwp007, s863-7, a2mb, endodermin, Alpha-2-M
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • A2m (Rat) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3352887
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
alpha-2-Macroglobulin
Species:
Human
Synonyms:
A2MD, CPAMD5, FWP007, S863-7, A2MAC1, A2m1, A2maa, Mam, A2mp, A2M, LOC733429, endod, cpamd5, fwp007, s863-7, a2mb, endodermin, Alpha-2-M
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • A2M (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3262496
$420.00
1 kit
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
alpha-2-Macroglobulin (A2M)
NCBI Accession:
NM_175628
Species:
Mouse (Murine)
Synonyms:
A2M, A2m, LOC477699, pzp.L, AZL_c00450, LOC100349077, a2m, LOC100061656, LOC100090399, a2m.S, LOC100469973, LOC100595735, PZP, LOC100353095, LOC101122940, LOC101801552, LOC100911545
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of A2m
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5114262
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
alpha-2-Macroglobulin (A2M)
NCBI Accession:
NM_012488
Species:
Rat (Rattus)
Synonyms:
A2M, A2m, LOC477699, pzp.L, AZL_c00450, LOC100349077, a2m, LOC100061656, LOC100090399, a2m.S, LOC100469973, LOC100595735, PZP, LOC100353095, LOC101122940, LOC101801552, LOC100911545
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of A2m
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5114264
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
alpha-2-Macroglobulin (A2M)
NCBI Accession:
NM_000014
Species:
Human
Synonyms:
A2M, A2m, LOC477699, pzp.L, AZL_c00450, LOC100349077, a2m, LOC100061656, LOC100090399, a2m.S, LOC100469973, LOC100595735, PZP, LOC100353095, LOC101122940, LOC101801552, LOC100911545
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of A2M
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5114260
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
alpha-2-Macroglobulin (A2M)
Gene ID:
2 (Human, A2M)
Synonyms:
A2M, A2m, LOC477699, pzp.L, AZL_c00450, LOC100349077, a2m, LOC100061656, LOC100090399, a2m.S, LOC100469973, LOC100595735, PZP, LOC100353095, LOC101122940, LOC101801552, LOC100911545
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter, U6 Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable

Viral particles:
ABIN5050909

Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN5031964
$503.00
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
alpha-2-Macroglobulin
Gene ID:
2 (Human, A2M)
Synonyms:
A2MD, CPAMD5, FWP007, S863-7, A2MAC1, A2m1, A2maa, Mam, A2mp, A2M, LOC733429, endod, cpamd5, fwp007, s863-7, a2mb, endodermin, Alpha-2-M
Purification:
Oligonucleotide synthesis is monitored base by base through trityl analysis to ensure appropriate coupling efficiency. The oligo is subsequently purified by affinity-solid phase extraction. The annealed RNA duplex is further analyzed by mass spectrometry to verify the exact composition of the duplex. Each lot is compared to the previous lot by mass spectrometry to ensure maximum lot-to-lot consistency.
Components:
This product is provided as two 5 nmol vials (10 nmol), three 5 nmol vials (15 nmol) or 2x three 5 nmol vials (30 nmol) of lyophilized siRNA oligo duplexes. Each vial contains slightly different sequences to ensure full knockout of the gene. Each vial contains slightly different sequences to ensure full knockout of the gene. The duplexes can be transfected individually or pooled together to achieve knockdown of the target gene, which is most commonly assessed by qPCR or western blot. The siRNA oligos are also chemically modified (2'-OMe) for increased stability and enhanced knockdown in vitro and in vivo.
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5789563
$516.85
Plus shipping costs $45.00
Delivery in 16 to 26 Business Days

Application:
RNA Interference
Gene:
alpha-2-Macroglobulin
Gene ID:
24153 (Rat (Rattus), A2M)
Synonyms:
A2MD, CPAMD5, FWP007, S863-7, A2MAC1, A2m1, A2maa, Mam, A2mp, A2M, LOC733429, endod, cpamd5, fwp007, s863-7, a2mb, endodermin, Alpha-2-M
Purification:
Oligonucleotide synthesis is monitored base by base through trityl analysis to ensure appropriate coupling efficiency. The oligo is subsequently purified by affinity-solid phase extraction. The annealed RNA duplex is further analyzed by mass spectrometry to verify the exact composition of the duplex. Each lot is compared to the previous lot by mass spectrometry to ensure maximum lot-to-lot consistency.
Components:
This product is provided as two 5 nmol vials (10 nmol), three 5 nmol vials (15 nmol) or 2x three 5 nmol vials (30 nmol) of lyophilized siRNA oligo duplexes. Each vial contains slightly different sequences to ensure full knockout of the gene. Each vial contains slightly different sequences to ensure full knockout of the gene. The duplexes can be transfected individually or pooled together to achieve knockdown of the target gene, which is most commonly assessed by qPCR or western blot. The siRNA oligos are also chemically modified (2'-OMe) for increased stability and enhanced knockdown in vitro and in vivo.
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5789564
$516.85
Plus shipping costs $45.00
Delivery in 16 to 26 Business Days

Application:
RNA Interference
Gene:
alpha-2-Macroglobulin
Gene ID:
11287 (Mouse (Murine), A2M)
Synonyms:
A2MD, CPAMD5, FWP007, S863-7, A2MAC1, A2m1, A2maa, Mam, A2mp, A2M, LOC733429, endod, cpamd5, fwp007, s863-7, a2mb, endodermin, Alpha-2-M
Purification:
Oligonucleotide synthesis is monitored base by base through trityl analysis to ensure appropriate coupling efficiency. The oligo is subsequently purified by affinity-solid phase extraction. The annealed RNA duplex is further analyzed by mass spectrometry to verify the exact composition of the duplex. Each lot is compared to the previous lot by mass spectrometry to ensure maximum lot-to-lot consistency.
Components:
This product is provided as two 5 nmol vials (10 nmol), three 5 nmol vials (15 nmol) or 2x three 5 nmol vials (30 nmol) of lyophilized siRNA oligo duplexes. Each vial contains slightly different sequences to ensure full knockout of the gene. Each vial contains slightly different sequences to ensure full knockout of the gene. The duplexes can be transfected individually or pooled together to achieve knockdown of the target gene, which is most commonly assessed by qPCR or western blot. The siRNA oligos are also chemically modified (2'-OMe) for increased stability and enhanced knockdown in vitro and in vivo.
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5789565
$516.85
Plus shipping costs $45.00
Delivery in 16 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to alpha 2 Macroglobulin

  • alpha-2-macroglobulin (A2M)
  • alpha-2-macroglobulin (A2m)
  • alpha-2-macroglobulin (LOC477699)
  • pregnancy-zone protein L homeolog (pzp.L)
  • alpha-2-macroglobulin (AZL_c00450)
  • alpha-2-macroglobulin (LOC100349077)
  • alpha-2-macroglobulin (a2m)
  • alpha-2-macroglobulin (LOC100061656)
  • alpha-2-macroglobulin (LOC100090399)
  • alpha-2-macroglobulin S homeolog (a2m.S)
  • alpha-2-macroglobulin (LOC100469973)
  • alpha-2-macroglobulin (LOC100595735)
  • pregnancy zone protein (PZP)
  • alpha-2-macroglobulin (LOC100353095)
  • alpha-2-macroglobulin (LOC101122940)
  • alpha-2-macroglobulin (LOC101801552)
  • alpha-2-macroglobulin-like (LOC100911545)
  • A2M
  • A2m1
  • A2maa
  • A2MAC1
  • a2mb
  • A2MD
  • A2mp
  • Alpha-2-M
  • CPAMD5
  • cpamd5
  • endod
  • endodermin
  • fwp007
  • FWP007
  • LOC733429
  • Mam
  • S863-7
  • s863-7

Gene-IDs for different species

GENE IDSPECIES
2 Homo sapiens
24153 Rattus norvegicus
232345 Mus musculus
403166 Sus scrofa
418251 Gallus gallus
465372 Pan troglodytes
477699 Canis lupus familiaris
513856 Bos taurus
716834 Macaca mulatta
733429 Xenopus laevis
8794592 Azospirillum sp. B510
100173946 Pongo abelii
100349077 Oryctolagus cuniculus
100390764 Callithrix jacchus
619586 Xenopus (Silurana) tropicalis
100061656 Equus caballus
100090399 Ornithorhynchus anatinus
100158443 Xenopus laevis
100469973 Ailuropoda melanoleuca
100595735 Nomascus leucogenys
100153288 Sus scrofa
100353095 Oryctolagus cuniculus
101122940 Ovis aries
101801552 Anas platyrhynchos
100911545 Rattus norvegicus
101794357 Anas platyrhynchos

Protein level used designations for alpha 2 Macroglobulin

  • C3 and PZP-like alpha-2-macroglobulin domain-containing protein 5
  • alpha-2-M
  • alpha-2-macroglobulin-P
  • alpha-2-macroglobulin
  • alpha-2-macroglobulin-like
  • alpha 2m
  • endodermin
  • Alpha2-macroglobulin
  • alpha-2-macroglobulin b
  • pregnancy zone protein
Other products related to alpha 2 Macroglobulin such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com