AXL (AXL Receptor tyrosine Kinase, AXL)

Short Description: The protein encoded by this gene is a member of the receptor tyrosine kinase subfamily. Although it is similar to other receptor tyrosine kinases, this protein represents a unique structure of the extracellular region that juxtaposes IgL and FNIII repeats. It transduces signals from the extracellular matrix into the cytoplasm by binding growth factors like vitamin K-dependent protein growth-arrest-specific gene 6. It is involved in the stimulation of cell proliferation and can also mediate cell aggregation by homophilic binding. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008].
More information related to gene AXL.
Products related to AXL Gene:
175 Products
Data Quality
  • 2
  • 5
Type
  • 169
  • 6
Species
  • 75
  • 59
  • 39
  • 2
Application
  • 112
  • 43
  • 22
  • 16
  • 2
Fusion tag
  • 52
  • 23
  • 22
  • 20
  • 10
Vector Backbone
  • 13
  • 13
  • 11
  • 7
  • 6
Vector
  • 77
  • 47
  • 24
  • 9
  • 8
Insert
  • 69
  • 66
  • 18
  • 8
  • 6
Oligo-Type
  • 4
  • 2
Resistance Gene
  • 85
  • 45
  • 32
  • 7
  • 2
Expression Type
  • 141
  • 61
  • 22
Selectable Marker
  • 43
  • 24
  • 22
Promoter
  • 62
  • 41
  • 30
  • 27
  • 8
Format
  • 80
  • 54
  • 27
  • 14

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
AXL Receptor tyrosine Kinase (AXL)
Gene ID:
26362 (Mouse (Murine), AXL)
Synonyms:
AXL, Axl
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3812387
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
AXL Receptor tyrosine Kinase (AXL)
Gene ID:
558 (Human, AXL)
Synonyms:
AXL, Axl
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3803255
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
AXL Receptor tyrosine Kinase (AXL)
Gene ID:
100036629 (Xenopus tropicalis, AXL)
Synonyms:
AXL, Axl
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3871684
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
AXL Receptor tyrosine Kinase (AXL)
Gene ID:
26362 (Mouse (Murine), AXL)
Synonyms:
AXL, Axl
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6.1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3875648
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
AXL Receptor tyrosine Kinase (AXL)
NCBI Accession:
NM_009465
Species:
Mouse (Murine)
Synonyms:
AXL, Axl
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3886364
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
AXL Receptor tyrosine Kinase (AXL)
NCBI Accession:
NM_021913
Species:
Human
Synonyms:
AXL, Axl
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3886363
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
AXL Receptor tyrosine Kinase
Species:
Human
Synonyms:
JTK11, UFO, AI323647, Ark, Tyro7, Ufo
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3188661
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
AXL Receptor tyrosine Kinase
Species:
Mouse (Murine)
Synonyms:
JTK11, UFO, AI323647, Ark, Tyro7, Ufo
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3193712
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
ORF
Application:
Cloning
Gene:
AXL Receptor tyrosine Kinase (AXL)
Species:
Human
Synonyms:
AXL, Axl
Insert length:
2685 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5746831
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
AXL Receptor tyrosine Kinase (AXL)
Gene ID:
26362 (Mouse (Murine), AXL)
Synonyms:
AXL, Axl
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3812390
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
AXL Receptor tyrosine Kinase (AXL)
Gene ID:
26362 (Mouse (Murine), AXL)
Synonyms:
AXL, Axl
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3812389
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
AXL Receptor tyrosine Kinase (AXL)
Gene ID:
558 (Human, AXL)
Synonyms:
AXL, Axl
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3803256
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
AXL Receptor tyrosine Kinase (AXL)
Gene ID:
100036629 (Xenopus tropicalis, AXL)
Synonyms:
AXL, Axl
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3871685
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
AXL Receptor tyrosine Kinase (AXL)
Gene ID:
558 (Human, AXL)
Synonyms:
AXL, Axl
Insert length:
2685 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5318808
$214.67
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
AXL Receptor tyrosine Kinase (AXL)
NCBI Accession:
NM_021913,NP_068713
Species:
Human
Synonyms:
AXL, Axl
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948184

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Iaboni, Russo, Fontanella, Roscigno, Fiore, Donnarumma, Esposito, Quintavalle, Giangrande, de Franciscis, Condorelli: "Aptamer-miRNA-212 Conjugate Sensitizes NSCLC Cells to TRAIL." in: Molecular therapy. Nucleic acids, Vol. 5, Issue , pp. e289, 2016 (Pubmed)
  • Salian-Mehta, Xu, Knox, Plummer, Slavov, Taylor, Bevers, Hodges, Crowley, Wierman: "Functional consequences of AXL sequence variants in hypogonadotropic hypogonadism." in: The Journal of clinical endocrinology and metabolism, Vol. 99, Issue 4, pp. 1452-60, 2014 (Pubmed)
  • Xu, Chan, Liu, Wong, Fan, Chen, Poon, Zender, Lowe, Hong, Luk: "AXL receptor kinase is a mediator of YAP-dependent oncogenic functions in hepatocellular carcinoma." in: Oncogene, Vol. 30, Issue 10, pp. 1229-40, 2011 (Pubmed)
Catalog No. ABIN3388375
$300.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
AXL Receptor tyrosine Kinase (AXL)
Species:
Human
Synonyms:
AXL, Axl
Insert length:
2685 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-N-D-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag,HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4499133
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
AXL Receptor tyrosine Kinase (AXL)
Species:
Human
Synonyms:
AXL, Axl
Insert length:
2685 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4697927
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
AXL Receptor tyrosine Kinase (AXL)
Species:
Human
Synonyms:
AXL, Axl
Insert length:
2685 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4758826
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
AXL Receptor tyrosine Kinase (AXL)
Species:
Human
Synonyms:
AXL, Axl
Insert length:
2685 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4764119
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
AXL Receptor tyrosine Kinase (AXL)
Species:
Human
Synonyms:
AXL, Axl
Insert length:
2685 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4433546
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to AXL

  • AXL receptor tyrosine kinase (AXL)
  • AXL receptor tyrosine kinase (Axl)
  • Axl receptor tyrosine kinase (Axl)
  • AI323647
  • Ark
  • JTK11
  • Tyro7
  • UFO
  • Ufo

Gene-IDs for different species

GENE IDSPECIES
100064907 Equus caballus
558 Homo sapiens
26362 Mus musculus
308444 Rattus norvegicus
484490 Canis lupus familiaris
100144875 Sus scrofa
516598 Bos taurus

Protein level used designations for AXL

  • AXL oncogene
  • AXL transforming sequence/gene
  • tyrosine-protein kinase receptor UFO
  • adhesion-related kinase
  • ufo oncogene homolog
Other products related to AXL such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com