B3GALT1 (UDP-Gal:betaGlcNAc beta 1,3-Galactosyltransferase, Polypeptide 1, B3GALT1)

Short Description: This gene is a member of the beta-1,3-galactosyltransferase (beta3GalT) gene family. This family encodes type II membrane-bound glycoproteins with diverse enzymatic functions using different donor substrates (UDP-galactose and UDP-N-acetylglucosamine) and different acceptor sugars (N-acetylglucosamine, galactose, N-acetylgalactosamine). The beta3GalT genes are distantly related to the Drosophila Brainiac gene and have the protein coding sequence contained in a single exon. The beta3GalT proteins also contain conserved sequences not found in the beta4GalT or alpha3GalT proteins. The carbohydrate chains synthesized by these enzymes are designated as type 1, whereas beta4GalT enzymes synthesize type 2 carbohydrate chains. The ratio of type 1:type 2 chains changes during embryogenesis. By sequence similarity, the beta3GalT genes fall into at least two groups: beta3GalT4 and 4 other beta3GalT genes (beta3GalT1-3, beta3GalT5). This gene is expressed exclusively in the brain. The encoded protein shows strict donor substrate specificity for UDP-galactose. [provided by RefSeq, Jul 2008].
More information related to gene B3GALT1.
Products related to B3GALT1 Gene:
108 Products
Type
  • 104
  • 4
Species
  • 47
  • 37
  • 24
Application
  • 57
  • 24
  • 23
  • 16
Fusion tag
  • 35
  • 15
  • 11
  • 10
  • 8
Vector Backbone
  • 8
  • 6
  • 6
  • 6
  • 6
Vector
  • 36
  • 35
  • 12
  • 11
  • 9
Insert
  • 38
  • 30
  • 20
  • 8
  • 6
Oligo-Type
  • 4
Resistance Gene
  • 46
  • 39
  • 18
  • 2
  • 1
Expression Type
  • 79
  • 48
  • 13
Selectable Marker
  • 33
  • 26
  • 13
Promoter
  • 30
  • 30
  • 18
  • 12
  • 8
Format
  • 47
  • 24
  • 22
  • 15

Type:
cDNA
Application:
Cloning
Gene:
UDP-Gal:betaGlcNAc beta 1,3-Galactosyltransferase, Polypeptide 1 (B3GALT1)
Gene ID:
26877 (Mouse (Murine), B3GALT1)
Synonyms:
B3GALT1, B3galt1
Vector type:
Cloning Vector
Vector backbone:
pYX-Asc
Resistance Gene:
Ampicillin
Promoter:
T3 Promoter

Sequencing Primer:
  • T7
  • T3
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4100054
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
UDP-Gal:betaGlcNAc beta 1,3-Galactosyltransferase, Polypeptide 1 (B3GALT1)
Gene ID:
26877 (Mouse (Murine), B3GALT1)
Synonyms:
B3GALT1, B3galt1
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4004749
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
UDP-Gal:betaGlcNAc beta 1,3-Galactosyltransferase, Polypeptide 1 (B3GALT1)
Gene ID:
26877 (Mouse (Murine), B3GALT1)
Synonyms:
B3GALT1, B3galt1
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4004750
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
UDP-Gal:betaGlcNAc beta 1,3-Galactosyltransferase, Polypeptide 1 (B3GALT1)
Gene ID:
8708 (Human, B3GALT1)
Synonyms:
B3GALT1, B3galt1
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4000880
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
UDP-Gal:betaGlcNAc beta 1,3-Galactosyltransferase, Polypeptide 1 (B3GALT1)
Gene ID:
8708 (Human, B3GALT1)
Synonyms:
B3GALT1, B3galt1
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4000879
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
UDP-Gal:betaGlcNAc beta 1,3-Galactosyltransferase, Polypeptide 1 (B3GALT1)
NCBI Accession:
NM_020283
Species:
Mouse (Murine)
Synonyms:
B3GALT1, B3galt1
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3557662
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
UDP-Gal:betaGlcNAc beta 1,3-Galactosyltransferase, Polypeptide 1 (B3GALT1)
Gene ID:
26877 (Mouse (Murine), B3GALT1)
Synonyms:
B3GALT1, B3galt1
Vector type:
Cloning Vector
Vector backbone:
pYX-Asc
Resistance Gene:
Ampicillin
Promoter:
T3 Promoter

Sequencing Primer:
  • T7
  • T3
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4100055
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
UDP-Gal:betaGlcNAc beta 1,3-Galactosyltransferase, Polypeptide 1 (B3GALT1)
Gene ID:
26877 (Mouse (Murine), B3GALT1)
Synonyms:
B3GALT1, B3galt1
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4004748
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
UDP-Gal:betaGlcNAc beta 1,3-Galactosyltransferase, Polypeptide 1 (B3GALT1)
Gene ID:
26877 (Mouse (Murine), B3GALT1)
Synonyms:
B3GALT1, B3galt1
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4004747
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
UDP-Gal:betaGlcNAc beta 1,3-Galactosyltransferase, Polypeptide 1 (B3GALT1)
Gene ID:
8708 (Human, B3GALT1)
Synonyms:
B3GALT1, B3galt1
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4000878
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
UDP-Gal:betaGlcNAc beta 1,3-Galactosyltransferase, Polypeptide 1 (B3GALT1)
Gene ID:
8708 (Human, B3GALT1)
Synonyms:
B3GALT1, B3galt1
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4000881
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
UDP-Gal:betaGlcNAc beta 1,3-Galactosyltransferase, Polypeptide 1 (B3GALT1)
NCBI Accession:
NM_020981
Gene ID:
8708 (Human, B3GALT1)
Synonyms:
B3GALT1, B3galt1
Insert length:
981 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4941291
$199.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 6 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
UDP-Gal:betaGlcNAc beta 1,3-Galactosyltransferase, Polypeptide 1 (B3GALT1)
NCBI Accession:
NM_020283
Species:
Mouse (Murine)
Synonyms:
B3GALT1, B3galt1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-Myc
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
MYC tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948164

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN4106598
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
UDP-Gal:betaGlcNAc beta 1,3-Galactosyltransferase, Polypeptide 1 (B3GALT1)
NCBI Accession:
NM_020283
Species:
Mouse (Murine)
Synonyms:
B3GALT1, B3galt1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948163

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN4106596
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
UDP-Gal:betaGlcNAc beta 1,3-Galactosyltransferase, Polypeptide 1 (B3GALT1)
NCBI Accession:
NM_020283
Species:
Mouse (Murine)
Synonyms:
B3GALT1, B3galt1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948165

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN4106597
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
UDP-Gal:betaGlcNAc beta 1,3-Galactosyltransferase, Polypeptide 1 (B3GALT1)
NCBI Accession:
NM_020283
Species:
Mouse (Murine)
Synonyms:
B3GALT1, B3galt1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-N-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948169

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN4106603
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
UDP-Gal:betaGlcNAc beta 1,3-Galactosyltransferase, Polypeptide 1 (B3GALT1)
NCBI Accession:
NM_020283
Species:
Mouse (Murine)
Synonyms:
B3GALT1, B3galt1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-N-Myc
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
MYC tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948168

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN4106604
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
UDP-Gal:betaGlcNAc beta 1,3-Galactosyltransferase, Polypeptide 1 (B3GALT1)
NCBI Accession:
NM_020283
Species:
Mouse (Murine)
Synonyms:
B3GALT1, B3galt1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-N-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948167

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN4106602
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
UDP-Gal:betaGlcNAc beta 1,3-Galactosyltransferase, Polypeptide 1 (B3GALT1)
NCBI Accession:
NM_020283
Species:
Mouse (Murine)
Synonyms:
B3GALT1, B3galt1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-N-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948166

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN4106600
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
UDP-Gal:betaGlcNAc beta 1,3-Galactosyltransferase, Polypeptide 1 (B3GALT1)
NCBI Accession:
NM_020283
Species:
Mouse (Murine)
Synonyms:
B3GALT1, B3galt1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-untagged
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable

Empty vector controls:
ABIN4948161

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN4106606
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to B3GALT1

  • beta-1,3-galactosyltransferase 1 (B3GALT1)
  • UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 1 (B3galt1)
  • Beta-1,3-galactosyltransferase 1 (B3galt1)
  • beta3Gal-T1
  • Beta3GalT1

Gene-IDs for different species

GENE IDSPECIES
8708 Homo sapiens
26877 Mus musculus
366064 Rattus norvegicus
429027 Gallus gallus
459710 Pan troglodytes
100986605 Pan paniscus
101122666 Ovis aries

Protein level used designations for B3GALT1

  • UDP-galactose:beta-N-acetyl-glucosamine-beta-1,3-galactosyltransferase 1
  • beta-1,3-GalTase 1
  • beta-1,3-galactosyltransferase 1
  • beta-3-galt1
  • beta3GalT1
  • UDP-galactose:beta-N-acetylglucosamine beta1, 3-galactosyltransferase 1
  • UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase 1
  • beta3Gal-T1
  • Beta-1,3-GalTase 1
  • Beta-1,3-galactosyltransferase 1
  • Beta3Gal-T1
  • beta 1,3-galactosyltransferase polypeptide 1
Other products related to B3GALT1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com