BDNF (Brain-Derived Neurotrophic Factor, BDNF)

Short Description: The protein encoded by this gene is a member of the nerve growth factor family. It is induced by cortical neurons, and is necessary for survival of striatal neurons in the brain. Expression of this gene is reduced in both Alzheimer's and Huntington disease patients. This gene may play a role in the regulation of stress response and in the biology of mood disorders. Multiple transcript variants encoding distinct isoforms have been described for this gene. [provided by RefSeq, Jan 2009].
More information related to gene BDNF.
Products related to BDNF Gene:
302 Products
Type
  • 294
  • 8
Species
  • 147
  • 85
  • 46
  • 12
  • 6
Application
  • 236
  • 52
  • 25
  • 24
  • 2
Fusion tag
  • 92
  • 59
  • 56
  • 24
  • 12
Vector Backbone
  • 48
  • 30
  • 30
  • 17
  • 10
Vector
  • 157
  • 90
  • 24
  • 9
  • 7
Insert
  • 155
  • 96
  • 19
  • 12
  • 10
Oligo-Type
  • 6
  • 2
Resistance Gene
  • 136
  • 84
  • 66
  • 8
  • 2
Expression Type
  • 251
  • 90
  • 35
Selectable Marker
  • 82
  • 35
  • 28
  • 1
Promoter
  • 136
  • 82
  • 39
  • 29
  • 12
Format
  • 180
  • 54
  • 43
  • 25

Type:
ORF
Application:
Cloning
Gene:
Brain-Derived Neurotrophic Factor (BDNF)
Species:
Human
Synonyms:
BDNF, Bdnf, bdnf, bdnf.L, bdnf.S
Insert length:
744 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5738333
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Brain-Derived Neurotrophic Factor (BDNF)
NCBI Accession:
NM_170733,NP_733929
Species:
Human
Synonyms:
BDNF, Bdnf, bdnf, bdnf.L, bdnf.S
Insert length:
744 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5394009
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Brain-Derived Neurotrophic Factor (BDNF)
NCBI Accession:
NM_001709,NP_001700
Species:
Human
Synonyms:
BDNF, Bdnf, bdnf, bdnf.L, bdnf.S
Insert length:
744 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5394010
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Brain-Derived Neurotrophic Factor (BDNF)
NCBI Accession:
NM_170731,NP_733927
Species:
Human
Synonyms:
BDNF, Bdnf, bdnf, bdnf.L, bdnf.S
Insert length:
768 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5394011
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Brain-Derived Neurotrophic Factor (BDNF)
NCBI Accession:
NM_170734,NP_733930
Species:
Human
Synonyms:
BDNF, Bdnf, bdnf, bdnf.L, bdnf.S
Insert length:
789 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5394012
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Brain-Derived Neurotrophic Factor (BDNF)
NCBI Accession:
NM_170735,NP_733931
Species:
Human
Synonyms:
BDNF, Bdnf, bdnf, bdnf.L, bdnf.S
Insert length:
744 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5394013
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Brain-Derived Neurotrophic Factor (BDNF)
Gene ID:
12064 (Mouse (Murine), BDNF)
Synonyms:
BDNF, Bdnf, bdnf, bdnf.L, bdnf.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pTCN
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • 3-1291
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4098112
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Brain-Derived Neurotrophic Factor (BDNF)
Gene ID:
58118 (Zebrafish (Danio rerio), BDNF)
Synonyms:
BDNF, Bdnf, bdnf, bdnf.L, bdnf.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6.1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3875939
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Brain-Derived Neurotrophic Factor (BDNF)
Gene ID:
58118 (Zebrafish (Danio rerio), BDNF)
Synonyms:
BDNF, Bdnf, bdnf, bdnf.L, bdnf.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6.1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3875940
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Brain-Derived Neurotrophic Factor (BDNF)
Gene ID:
58118 (Zebrafish (Danio rerio), BDNF)
Synonyms:
BDNF, Bdnf, bdnf, bdnf.L, bdnf.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6.1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3875941
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Brain-Derived Neurotrophic Factor (BDNF)
Gene ID:
100048914 (Xenopus laevis, BDNF)
Synonyms:
BDNF, Bdnf, bdnf, bdnf.L, bdnf.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3984840
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Brain-Derived Neurotrophic Factor (BDNF)
Gene ID:
24225 (Rat (Rattus), BDNF)
Synonyms:
BDNF, Bdnf, bdnf, bdnf.L, bdnf.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4045274
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Brain-Derived Neurotrophic Factor (BDNF)
Gene ID:
617701 (Cow (Bovine), BDNF)
Synonyms:
BDNF, Bdnf, bdnf, bdnf.L, bdnf.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3867590
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Brain-Derived Neurotrophic Factor (BDNF)
Gene ID:
100037853 (Xenopus tropicalis, BDNF)
Synonyms:
BDNF, Bdnf, bdnf, bdnf.L, bdnf.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3872122
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Brain-Derived Neurotrophic Factor (BDNF)
Gene ID:
627 (Human, BDNF)
Synonyms:
BDNF, Bdnf, bdnf, bdnf.L, bdnf.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3471080
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Brain-Derived Neurotrophic Factor (BDNF)
NCBI Accession:
NM_001709
Species:
Human
Synonyms:
BDNF, Bdnf, bdnf, bdnf.L, bdnf.S
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN4103770
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Brain-Derived Neurotrophic Factor (BDNF)
NCBI Accession:
NM_001002975
Species:
Dog (Canine)
Synonyms:
BDNF, Bdnf, bdnf, bdnf.L, bdnf.S
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3557736
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Brain-Derived Neurotrophic Factor (BDNF)
NCBI Accession:
NM_001048139
Species:
Mouse (Murine)
Synonyms:
BDNF, Bdnf, bdnf, bdnf.L, bdnf.S
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6
  • T7
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3887564
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Brain-Derived Neurotrophic Factor
Species:
Human
Synonyms:
ANON2, BULN2, bdnf-A, BDNF, bdnf
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3188489
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
Brain-Derived Neurotrophic Factor
Species:
Mouse (Murine)
Synonyms:
ANON2, BULN2, bdnf-A, BDNF, bdnf
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3193822
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days
  • <
  • 1
  • ...
  • ...

Synonyms and alternative names related to BDNF

  • brain derived neurotrophic factor (BDNF)
  • brain-derived neurotrophic factor (Bdnf)
  • brain derived neurotrophic factor (Bdnf)
  • brain-derived neurotrophic factor (bdnf)
  • brain-derived neurotrophic factor L homeolog (bdnf.L)
  • brain-derived neurotrophic factor S homeolog (bdnf.S)
  • brain-derived neurotrophic factor (BDNF)
  • ANON2
  • BDNF
  • bdnf
  • bdnf-A
  • BULN2

Gene-IDs for different species

GENE IDSPECIES
627 Homo sapiens
24225 Rattus norvegicus
12064 Mus musculus
58118 Danio rerio
378585 Xenopus laevis
396186 Gallus gallus
397495 Sus scrofa
403461 Canis lupus familiaris
493690 Felis catus
503511 Pan troglodytes
554233 Monodelphis domestica
617701 Bos taurus
701245 Macaca mulatta
751584 Taeniopygia guttata
100009689 Equus caballus
100037853 Xenopus (Silurana) tropicalis
100048914 Xenopus laevis
100313500 Oncorhynchus mykiss
100500698 Ailuropoda melanoleuca
100730257 Cavia porcellus
100356949 Oryctolagus cuniculus
101117275 Ovis aries

Protein level used designations for BDNF

  • abrineurin
  • neurotrophin
  • brain derived neurothrophic factor
  • brain derived neurotrophic factor
  • anorexia BDNF
  • brain-derived neurotrophic factor
  • neurotrophic factor
  • pre-pro-brain-derived
Other products related to BDNF such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com