beta-2 Microglobulin (beta-2-Microglobulin, B2M)

Short Description: This gene encodes a serum protein found in association with the major histocompatibility complex (MHC) class I heavy chain on the surface of nearly all nucleated cells. The protein has a predominantly beta-pleated sheet structure that can form amyloid fibrils in some pathological conditions. A mutation in this gene has been shown to result in hypercatabolic hypoproteinemia.[provided by RefSeq, Sep 2009].
More information related to gene beta-2 Microglobulin.
Products related to beta-2 Microglobulin Gene:
171 Products
Data Quality
  • 2
  • 162
  • 9
  • 55
  • 43
  • 41
  • 12
  • 12
  • 110
  • 35
  • 27
  • 16
  • 3
Fusion tag
  • 58
  • 19
  • 16
  • 13
  • 11
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
  • 87
  • 36
  • 12
  • 9
  • 9
  • 79
  • 46
  • 21
  • 8
  • 6
  • 6
  • 3
Resistance Gene
  • 86
  • 53
  • 18
  • 5
  • 2
Expression Type
  • 92
  • 55
  • 50
Selectable Marker
  • 55
  • 29
  • 26
  • 1
  • 69
  • 31
  • 31
  • 13
  • 8
  • 100
  • 27
  • 22
  • 22

beta-2-Microglobulin (B2M)
B2M, B2m, b2m, b2m.S
Insert length:
360 bp
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5738234
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Protein Expression
beta-2-Microglobulin (B2M)
NCBI Accession:
B2M, B2m, b2m, b2m.S
Insert length:
360 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5393595
10 μg
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Protein Expression, Cloning
beta-2-Microglobulin (B2M)
Gene ID:
30400 (Zebrafish (Danio rerio), B2M)
B2M, B2m, b2m, b2m.S
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4046414
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

beta-2-Microglobulin (B2M)
Gene ID:
30400 (Zebrafish (Danio rerio), B2M)
B2M, B2m, b2m, b2m.S
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3483936
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

beta-2-Microglobulin (B2M)
Gene ID:
30400 (Zebrafish (Danio rerio), B2M)
B2M, B2m, b2m, b2m.S
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3483937
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
beta-2-Microglobulin (B2M)
Gene ID:
280729 (Cow (Bovine), B2M)
B2M, B2m, b2m, b2m.S
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3838343
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
beta-2-Microglobulin (B2M)
Gene ID:
567 (Human, B2M)
B2M, B2m, b2m, b2m.S
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3471065
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
beta-2-Microglobulin (B2M)
Gene ID:
567 (Human, B2M)
B2M, B2m, b2m, b2m.S
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3471066
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

beta-2-Microglobulin (B2M)
NCBI Accession:
Rhesus Monkey
B2M, B2m, b2m, b2m.S
Vector type:
TA-Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Catalog No. ABIN3557656
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

beta-2-Microglobulin (B2M)
NCBI Accession:
B2M, B2m, b2m, b2m.S
Vector type:
TA-Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Catalog No. ABIN3557657
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

beta-2-Microglobulin (B2M)
NCBI Accession:
B2M, B2m, b2m, b2m.S
Vector type:
TA-Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Catalog No. ABIN3557658
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

beta-2-Microglobulin (B2M)
NCBI Accession:
Mouse (Murine)
B2M, B2m, b2m, b2m.S
Vector type:
TA-Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Catalog No. ABIN3557659
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

beta-2-Microglobulin (B2M)
NCBI Accession:
Rat (Rattus)
B2M, B2m, b2m, b2m.S
Vector type:
TA-Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • SP6
  • T7
  • M13-47
  • RV-M
Catalog No. ABIN3887531
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Quantitative real-time PCR
NCBI Accession:
Ly-m11, beta2-m, beta2m, bwm, wu:fa94c05, wu:fb10a09, b2m-W01, b2m-W03, b2m-Z01, b2m-Z02, b2m-Z03, B2M, b2m, B2MG, b-2-m
PCR Size:
139 bp
-20 °C
Catalog No. ABIN3188337
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Quantitative real-time PCR
Mouse (Murine)
Ly-m11, beta2-m, beta2m, bwm, wu:fa94c05, wu:fb10a09, b2m-W01, b2m-W03, b2m-Z01, b2m-Z02, b2m-Z03, B2M, b2m, B2MG, b-2-m
-20 °C
Catalog No. ABIN3194482
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Quantitative real-time PCR
Rat (Rattus)
Ly-m11, beta2-m, beta2m, bwm, wu:fa94c05, wu:fb10a09, b2m-W01, b2m-W03, b2m-Z01, b2m-Z02, b2m-Z03, B2M, b2m, B2MG, b-2-m
-20 °C
Catalog No. ABIN3196560
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Protein Expression, Cloning
beta-2-Microglobulin (B2M)
Gene ID:
30400 (Zebrafish (Danio rerio), B2M)
B2M, B2m, b2m, b2m.S
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4046415
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

beta-2-Microglobulin (B2M)
Gene ID:
30400 (Zebrafish (Danio rerio), B2M)
B2M, B2m, b2m, b2m.S
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4005269
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

beta-2-Microglobulin (B2M)
Gene ID:
30400 (Zebrafish (Danio rerio), B2M)
B2M, B2m, b2m, b2m.S
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4005268
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
beta-2-Microglobulin (B2M)
Gene ID:
280729 (Cow (Bovine), B2M)
B2M, B2m, b2m, b2m.S
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3838344
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
  • <
  • 1

Synonyms and alternative names related to beta-2 Microglobulin

  • beta-2-microglobulin (B2M)
  • beta-2 microglobulin (B2m)
  • beta-2-microglobulin (b2m)
  • beta-2-microglobulin S homeolog (b2m.S)
  • beta-2-microglobulin (B2m)
  • b-2-m
  • b2m
  • B2M
  • b2m-W01
  • b2m-W03
  • b2m-Z01
  • b2m-Z02
  • b2m-Z03
  • B2MG
  • beta2-m
  • beta2m
  • bwm
  • Ly-m11
  • wu:fa94c05
  • wu:fb10a09

Gene-IDs for different species

567 Homo sapiens
12010 Mus musculus
24223 Rattus norvegicus
30400 Danio rerio
280729 Bos taurus
397033 Sus scrofa
398171 Xenopus laevis
414830 Gallus gallus
443295 Ovis aries
450170 Pan troglodytes
494145 Felis catus
554191 Monodelphis domestica
712428 Macaca mulatta
791104 Ornithorhynchus anatinus
100034203 Equus caballus
100136933 Salmo salar
100174579 Pongo abelii
100379556 Cavia porcellus
100381194 Papio anubis
100304470 Ictalurus punctatus
100855741 Canis lupus familiaris
100350679 Oryctolagus cuniculus
100689409 Cricetulus griseus
101843036 Mesocricetus auratus
100404307 Callithrix jacchus
106835001 Equus asinus

Protein level used designations for beta-2 Microglobulin

  • beta chain of MHC class I molecules
  • beta-2-microglobin
  • beta-2-microglobulin
  • beta-2-microglobulin C-terminal fragment (55 AA)
  • lactollin
  • beta 2-microglobulin
  • beta-2 microglobulin
  • beta 2 microglobulin
  • beta-2-microglobulin-like protein
  • Beta-2-microglobulin
  • beta2 microglobulin
  • beta 2-m
  • beta 2 microglobulin (54 AA)
Other products related to beta-2 Microglobulin such as antibodies, ELISA kits and high-purity proteins are available on our partner website