beta-2 Microglobulin (beta-2-Microglobulin, B2M)

Short Description: This gene encodes a serum protein found in association with the major histocompatibility complex (MHC) class I heavy chain on the surface of nearly all nucleated cells. The protein has a predominantly beta-pleated sheet structure that can form amyloid fibrils in some pathological conditions. A mutation in this gene has been shown to result in hypercatabolic hypoproteinemia.[provided by RefSeq, Sep 2009].
More information related to gene beta-2 Microglobulin.
Products related to beta-2 Microglobulin Gene:
Data Quality
  • 2
Type
  • 159
  • 6
Species
  • 53
  • 41
  • 39
  • 12
  • 12
Application
  • 110
  • 35
  • 21
  • 16
  • 3
Fusion tag
  • 55
  • 19
  • 13
  • 13
  • 11
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
Vector
  • 84
  • 36
  • 12
  • 9
  • 9
Insert
  • 79
  • 46
  • 18
  • 8
  • 6
Oligo-Type
  • 3
  • 3
Resistance Gene
  • 83
  • 53
  • 18
  • 5
  • 2
Expression Type
  • 89
  • 55
  • 47
Selectable Marker
  • 55
  • 26
  • 26
  • 1
Promoter
  • 69
  • 28
  • 28
  • 13
  • 8
Format
  • 94
  • 27
  • 22
  • 22
165 Products

Type:
ORF
Application:
Cloning
Gene:
beta-2-Microglobulin (B2M)
Species:
Human
Synonyms:
B2M, B2m, b2m, b2m.S
Insert length:
360 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5738234
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
beta-2-Microglobulin (B2M)
NCBI Accession:
NM_004048,NP_004039
Species:
Human
Synonyms:
B2M, B2m, b2m, b2m.S
Insert length:
360 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5393595
$98.00
10 μg
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
cDNA
Application:
Cloning
Gene:
beta-2-Microglobulin (B2M)
Gene ID:
30400 (Zebrafish (Danio rerio), B2M)
Synonyms:
B2M, B2m, b2m, b2m.S
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3483936
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
beta-2-Microglobulin (B2M)
Gene ID:
30400 (Zebrafish (Danio rerio), B2M)
Synonyms:
B2M, B2m, b2m, b2m.S
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3483937
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
beta-2-Microglobulin (B2M)
Gene ID:
30400 (Zebrafish (Danio rerio), B2M)
Synonyms:
B2M, B2m, b2m, b2m.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4046414
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
beta-2-Microglobulin (B2M)
Gene ID:
567 (Human, B2M)
Synonyms:
B2M, B2m, b2m, b2m.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3471065
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
beta-2-Microglobulin (B2M)
Gene ID:
567 (Human, B2M)
Synonyms:
B2M, B2m, b2m, b2m.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3471066
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
beta-2-Microglobulin (B2M)
Gene ID:
280729 (Cow, B2M)
Synonyms:
B2M, B2m, b2m, b2m.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3838343
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
beta-2-Microglobulin (B2M)
NCBI Accession:
NM_001047137
Species:
Rhesus Monkey
Synonyms:
B2M, B2m, b2m, b2m.S
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3557656
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
beta-2-Microglobulin (B2M)
NCBI Accession:
NM_004048
Species:
Human
Synonyms:
B2M, B2m, b2m, b2m.S
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3557658
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
beta-2-Microglobulin (B2M)
NCBI Accession:
XM_004751289
Species:
Ferret
Synonyms:
B2M, B2m, b2m, b2m.S
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3557657
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
beta-2-Microglobulin (B2M)
NCBI Accession:
NM_012512
Species:
Rat
Synonyms:
B2M, B2m, b2m, b2m.S
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6
  • T7
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3887531
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
beta-2-Microglobulin (B2M)
NCBI Accession:
NM_009735
Species:
Mouse
Synonyms:
B2M, B2m, b2m, b2m.S
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3557659
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Application:
Quantitative real-time PCR
Gene:
beta-2-Microglobulin
NCBI Accession:
NM_004048
Species:
Human
Synonyms:
Ly-m11, beta2-m, beta2m, bwm, wu:fa94c05, wu:fb10a09, b2m-W01, b2m-W03, b2m-Z01, b2m-Z02, b2m-Z03, B2M, b2m, B2MG, b-2-m
PCR Size:
139 bp
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3188337
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
beta-2-Microglobulin
Species:
Rat
Synonyms:
Ly-m11, beta2-m, beta2m, bwm, wu:fa94c05, wu:fb10a09, b2m-W01, b2m-W03, b2m-Z01, b2m-Z02, b2m-Z03, B2M, b2m, B2MG, b-2-m
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3196560
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
beta-2-Microglobulin
Species:
Mouse
Synonyms:
Ly-m11, beta2-m, beta2m, bwm, wu:fa94c05, wu:fb10a09, b2m-W01, b2m-W03, b2m-Z01, b2m-Z02, b2m-Z03, B2M, b2m, B2MG, b-2-m
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3194482
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Cloning
Gene:
beta-2-Microglobulin (B2M)
Gene ID:
30400 (Zebrafish (Danio rerio), B2M)
Synonyms:
B2M, B2m, b2m, b2m.S
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4005268
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
beta-2-Microglobulin (B2M)
Gene ID:
30400 (Zebrafish (Danio rerio), B2M)
Synonyms:
B2M, B2m, b2m, b2m.S
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4005269
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
beta-2-Microglobulin (B2M)
Gene ID:
30400 (Zebrafish (Danio rerio), B2M)
Synonyms:
B2M, B2m, b2m, b2m.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4046415
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
beta-2-Microglobulin (B2M)
Gene ID:
567 (Human, B2M)
Synonyms:
B2M, B2m, b2m, b2m.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3471067
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
  • <
  • 1

Synonyms and alternative names related to beta-2 Microglobulin

  • beta-2-microglobulin (B2M)
  • beta-2 microglobulin (B2m)
  • beta-2-microglobulin (b2m)
  • beta-2-microglobulin S homeolog (b2m.S)
  • beta-2-microglobulin (B2m)
  • b-2-m
  • b2m
  • B2M
  • b2m-W01
  • b2m-W03
  • b2m-Z01
  • b2m-Z02
  • b2m-Z03
  • B2MG
  • beta2-m
  • beta2m
  • bwm
  • Ly-m11
  • wu:fa94c05
  • wu:fb10a09

Gene-IDs for different species

GENE IDSPECIES
567 Homo sapiens
12010 Mus musculus
24223 Rattus norvegicus
30400 Danio rerio
280729 Bos taurus
397033 Sus scrofa
398171 Xenopus laevis
414830 Gallus gallus
443295 Ovis aries
450170 Pan troglodytes
494145 Felis catus
554191 Monodelphis domestica
712428 Macaca mulatta
791104 Ornithorhynchus anatinus
100034203 Equus caballus
100136933 Salmo salar
100174579 Pongo abelii
100379556 Cavia porcellus
100381194 Papio anubis
100304470 Ictalurus punctatus
100855741 Canis lupus familiaris
100350679 Oryctolagus cuniculus
100689409 Cricetulus griseus
101843036 Mesocricetus auratus
100404307 Callithrix jacchus
106835001 Equus asinus

Protein level used designations for beta-2 Microglobulin

  • beta chain of MHC class I molecules
  • beta-2-microglobin
  • beta-2-microglobulin
  • beta-2-microglobulin C-terminal fragment (55 AA)
  • lactollin
  • beta 2-microglobulin
  • beta-2 microglobulin
  • beta 2 microglobulin
  • beta-2-microglobulin-like protein
  • Beta-2-microglobulin
  • beta2 microglobulin
  • beta 2-m
  • beta 2 microglobulin (54 AA)
Other products related to beta-2 Microglobulin such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com