Caspase 2 (Caspase 2, Apoptosis-Related Cysteine Peptidase, CASP2)

Short Description: This gene encodes a member of the cysteine-aspartic acid protease (caspase) family. Caspases mediate cellular apoptosis through the proteolytic cleavage of specific protein substrates. The encoded protein may function in stress-induced cell death pathways, cell cycle maintenance, and the suppression of tumorigenesis. Increased expression of this gene may play a role in neurodegenerative disorders including Alzheimer's disease, Huntington's disease and temporal lobe epilepsy. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011].
More information related to gene Caspase 2.
Products related to Caspase 2 Gene:
141 Products
Data Quality
  • 1
Type
  • 134
  • 7
Species
  • 62
  • 43
  • 28
  • 6
  • 2
Application
  • 85
  • 30
  • 27
  • 16
  • 1
Fusion tag
  • 46
  • 19
  • 13
  • 13
  • 8
Vector Backbone
  • 7
  • 7
  • 6
  • 6
  • 6
Vector
  • 61
  • 38
  • 12
  • 10
  • 9
Insert
  • 57
  • 40
  • 21
  • 8
  • 6
Oligo-Type
  • 6
  • 1
Resistance Gene
  • 60
  • 47
  • 22
  • 5
  • 2
Expression Type
  • 97
  • 55
  • 26
Selectable Marker
  • 33
  • 26
  • 26
  • 1
Promoter
  • 39
  • 35
  • 31
  • 12
  • 8
Format
  • 73
  • 27
  • 22
  • 19

Type:
ORF
Application:
Cloning
Gene:
Caspase 2, Apoptosis-Related Cysteine Peptidase (CASP2)
Species:
Human
Synonyms:
CASP2, casp2.L, CpipJ_CPIJ008254, Casp2
Insert length:
1359 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5749437
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Caspase 2, Apoptosis-Related Cysteine Peptidase (CASP2)
NCBI Accession:
NM_032982,NP_116764
Species:
Human
Synonyms:
CASP2, casp2.L, CpipJ_CPIJ008254, Casp2
Insert length:
1359 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5430739
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Caspase 2, Apoptosis-Related Cysteine Peptidase (CASP2)
Gene ID:
373118 (Zebrafish (Danio rerio), CASP2)
Synonyms:
CASP2, casp2.L, CpipJ_CPIJ008254, Casp2
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4017646
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Caspase 2, Apoptosis-Related Cysteine Peptidase (CASP2)
Gene ID:
373118 (Zebrafish (Danio rerio), CASP2)
Synonyms:
CASP2, casp2.L, CpipJ_CPIJ008254, Casp2
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4017647
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Caspase 2, Apoptosis-Related Cysteine Peptidase (CASP2)
Gene ID:
397817 (Xenopus laevis, CASP2)
Synonyms:
CASP2, casp2.L, CpipJ_CPIJ008254, Casp2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3845331
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Caspase 2, Apoptosis-Related Cysteine Peptidase (CASP2)
Gene ID:
12366 (Mouse (Murine), CASP2)
Synonyms:
CASP2, casp2.L, CpipJ_CPIJ008254, Casp2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3807895
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Caspase 2, Apoptosis-Related Cysteine Peptidase (CASP2)
Gene ID:
835 (Human, CASP2)
Synonyms:
CASP2, casp2.L, CpipJ_CPIJ008254, Casp2
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4083516
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Caspase 2, Apoptosis-Related Cysteine Peptidase (CASP2)
NCBI Accession:
NM_007610
Species:
Mouse (Murine)
Synonyms:
CASP2, casp2.L, CpipJ_CPIJ008254, Casp2
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3558046
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Caspase 2, Apoptosis-Related Cysteine Peptidase (CASP2)
NCBI Accession:
NM_032982
Species:
Human
Synonyms:
CASP2, casp2.L, CpipJ_CPIJ008254, Casp2
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3886460
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Caspase 2, Apoptosis-Related Cysteine Peptidase
Species:
Human
Synonyms:
xCaspase-2, Caspase-2, ICH-1, Nedd2, CASP-2, ICH1, NEDD-2, NEDD2, PPP1R57, ICH-1L/1S, ICH1L1S
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3188478
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Caspase 2, Apoptosis-Related Cysteine Peptidase (CASP2)
Gene ID:
373118 (Zebrafish (Danio rerio), CASP2)
Synonyms:
CASP2, casp2.L, CpipJ_CPIJ008254, Casp2
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4017648
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Caspase 2, Apoptosis-Related Cysteine Peptidase (CASP2)
Gene ID:
373118 (Zebrafish (Danio rerio), CASP2)
Synonyms:
CASP2, casp2.L, CpipJ_CPIJ008254, Casp2
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4017649
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Caspase 2, Apoptosis-Related Cysteine Peptidase (CASP2)
Gene ID:
397817 (Xenopus laevis, CASP2)
Synonyms:
CASP2, casp2.L, CpipJ_CPIJ008254, Casp2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3845332
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Caspase 2, Apoptosis-Related Cysteine Peptidase (CASP2)
Gene ID:
12366 (Mouse (Murine), CASP2)
Synonyms:
CASP2, casp2.L, CpipJ_CPIJ008254, Casp2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3807894
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Caspase 2, Apoptosis-Related Cysteine Peptidase (CASP2)
Gene ID:
835 (Human, CASP2)
Synonyms:
CASP2, casp2.L, CpipJ_CPIJ008254, Casp2
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4083517
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Caspase 2, Apoptosis-Related Cysteine Peptidase (CASP2)
Gene ID:
835 (Human, CASP2)
Synonyms:
CASP2, casp2.L, CpipJ_CPIJ008254, Casp2
Insert length:
1359 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5314813
$189.37
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Caspase 2, Apoptosis-Related Cysteine Peptidase (CASP2)
Species:
Human
Synonyms:
CASP2, casp2.L, CpipJ_CPIJ008254, Casp2
Insert length:
1359 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4434601
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Caspase 2, Apoptosis-Related Cysteine Peptidase (CASP2)
Species:
Human
Synonyms:
CASP2, casp2.L, CpipJ_CPIJ008254, Casp2
Insert length:
1359 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4473506
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Caspase 2, Apoptosis-Related Cysteine Peptidase (CASP2)
Species:
Human
Synonyms:
CASP2, casp2.L, CpipJ_CPIJ008254, Casp2
Insert length:
1359 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4759881
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Caspase 2, Apoptosis-Related Cysteine Peptidase (CASP2)
Species:
Human
Synonyms:
CASP2, casp2.L, CpipJ_CPIJ008254, Casp2
Insert length:
1359 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4765174
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to Caspase 2

  • caspase 2 (CASP2)
  • caspase 2 L homeolog (casp2.L)
  • caspase-2 (CpipJ_CPIJ008254)
  • caspase 2 (Casp2)
  • CASP-2
  • Caspase-2
  • ICH-1
  • ICH-1L/1S
  • ICH1
  • ICH1L1S
  • NEDD-2
  • Nedd2
  • NEDD2
  • PPP1R57
  • xCaspase-2

Gene-IDs for different species

GENE IDSPECIES
100050611 Equus caballus
397817 Xenopus laevis
6040179 Culex quinquefasciatus
64314 Rattus norvegicus
12366 Mus musculus
100101590 Oryctolagus cuniculus
835 Homo sapiens
482737 Canis lupus familiaris
531419 Bos taurus
395857 Gallus gallus
100735399 Cavia porcellus
100521118 Sus scrofa

Protein level used designations for Caspase 2

  • caspase-2
  • CASP-2
  • ICH-1 protease
  • protease ICH-1
  • NEDD-2
  • neural precursor cell expressed developmentally down-regulated protein 2
  • protein phosphatase 1, regulatory subunit 57
  • caspase 2, apoptosis-related cysteine peptidase (neural precursor cell expressed, developmentally down-regulated 2)
  • ICH1 protease
  • caspase 2, apoptosis-related cysteine protease
  • cysteine protease caspase-2
Other products related to Caspase 2 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com