Caspase 8 (Caspase 8, CASP8)

Short Description: This gene encodes a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes composed of a prodomain, a large protease subunit, and a small protease subunit. Activation of caspases requires proteolytic processing at conserved internal aspartic residues to generate a heterodimeric enzyme consisting of the large and small subunits. This protein is involved in the programmed cell death induced by Fas and various apoptotic stimuli. The N-terminal FADD-like death effector domain of this protein suggests that it may interact with Fas-interacting protein FADD. This protein was detected in the insoluble fraction of the affected brain region from Huntington disease patients but not in those from normal controls, which implicated the role in neurodegenerative diseases. Many alternatively spliced transcript variants encoding different isoforms have been described, although not all variants have had their full-length sequences determined. [provided by RefSeq, Jul 2008].
More information related to gene Caspase 8.
Products related to Caspase 8 Gene:
Type
  • 146
  • 4
Species
  • 79
  • 39
  • 26
  • 2
  • 2
Application
  • 99
  • 33
  • 21
  • 16
  • 1
Fusion tag
  • 45
  • 24
  • 21
  • 14
  • 8
  • 7
Vector Backbone
  • 12
  • 12
  • 9
  • 6
  • 6
Vector
  • 64
  • 47
  • 16
  • 9
  • 8
Insert
  • 60
  • 52
  • 18
  • 8
  • 6
Oligo-Type
  • 3
  • 1
Resistance Gene
  • 56
  • 53
  • 32
  • 5
  • 2
Expression Type
  • 127
  • 59
  • 13
Selectable Marker
  • 37
  • 26
  • 13
Promoter
  • 58
  • 30
  • 28
  • 21
  • 8
Format
  • 73
  • 36
  • 24
  • 17
150 Products

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Caspase 8, Apoptosis-Related Cysteine Peptidase (CASP8)
Gene ID:
58022 (Zebrafish (Danio rerio), CASP8)
Synonyms:
casp8.L, LOC661095, CASP8, LOC5563818, casp8, LOC100222284, Casp8
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4046626
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Caspase 8, Apoptosis-Related Cysteine Peptidase (CASP8)
Gene ID:
507481 (Cow (Bovine), CASP8)
Synonyms:
casp8.L, LOC661095, CASP8, LOC5563818, casp8, LOC100222284, Casp8
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4061631
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Caspase 8, Apoptosis-Related Cysteine Peptidase (CASP8)
Gene ID:
373559 (Xenopus laevis, CASP8)
Synonyms:
casp8.L, LOC661095, CASP8, LOC5563818, casp8, LOC100222284, Casp8
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4017665
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Caspase 8, Apoptosis-Related Cysteine Peptidase (CASP8)
Gene ID:
841 (Human, CASP8)
Synonyms:
casp8.L, LOC661095, CASP8, LOC5563818, casp8, LOC100222284, Casp8
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4083521
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Caspase 8, Apoptosis-Related Cysteine Peptidase (CASP8)
Gene ID:
12370 (Mouse (Murine), CASP8)
Synonyms:
casp8.L, LOC661095, CASP8, LOC5563818, casp8, LOC100222284, Casp8
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3463016
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Caspase 8, Apoptosis-Related Cysteine Peptidase (CASP8)
Gene ID:
12370 (Mouse (Murine), CASP8)
Synonyms:
casp8.L, LOC661095, CASP8, LOC5563818, casp8, LOC100222284, Casp8
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3463020
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Caspase 8 (CASP8)
NCBI Accession:
NM_033355
Species:
Human
Synonyms:
casp8.L, LOC661095, CASP8, LOC5563818, casp8, LOC100222284, Casp8
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3886465
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Caspase 8
Species:
Human
Synonyms:
casp8-A, xCaspase-8, casp8, CASP8, CASP-8, FLICE, MACH, Mch5, ALPS2B, CAP4, Casp-8, MCH5, caspase-8, zgc:92075
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3188499
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Caspase 8, Apoptosis-Related Cysteine Peptidase (CASP8)
Gene ID:
58022 (Zebrafish (Danio rerio), CASP8)
Synonyms:
casp8.L, LOC661095, CASP8, LOC5563818, casp8, LOC100222284, Casp8
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4046627
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Caspase 8, Apoptosis-Related Cysteine Peptidase (CASP8)
Gene ID:
12370 (Mouse (Murine), CASP8)
Synonyms:
casp8.L, LOC661095, CASP8, LOC5563818, casp8, LOC100222284, Casp8
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3807900
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Caspase 8, Apoptosis-Related Cysteine Peptidase (CASP8)
Gene ID:
373559 (Xenopus laevis, CASP8)
Synonyms:
casp8.L, LOC661095, CASP8, LOC5563818, casp8, LOC100222284, Casp8
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4017664
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Caspase 8, Apoptosis-Related Cysteine Peptidase (CASP8)
Gene ID:
507481 (Cow (Bovine), CASP8)
Synonyms:
casp8.L, LOC661095, CASP8, LOC5563818, casp8, LOC100222284, Casp8
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4061632
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Caspase 8, Apoptosis-Related Cysteine Peptidase (CASP8)
Gene ID:
841 (Human, CASP8)
Synonyms:
casp8.L, LOC661095, CASP8, LOC5563818, casp8, LOC100222284, Casp8
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4083520
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Caspase 8, Apoptosis-Related Cysteine Peptidase (CASP8)
Gene ID:
12370 (Mouse (Murine), CASP8)
Synonyms:
casp8.L, LOC661095, CASP8, LOC5563818, casp8, LOC100222284, Casp8
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3463019
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Caspase 8, Apoptosis-Related Cysteine Peptidase (CASP8)
Gene ID:
841 (Human, CASP8)
Synonyms:
casp8.L, LOC661095, CASP8, LOC5563818, casp8, LOC100222284, Casp8
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3413221
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Caspase 8, Apoptosis-Related Cysteine Peptidase (CASP8)
NCBI Accession:
NM_033358,NP_203522
Species:
Human
Synonyms:
casp8.L, LOC661095, CASP8, LOC5563818, casp8, LOC100222284, Casp8
Insert length:
2900 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948184

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3383036
$420.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Caspase 8, Apoptosis-Related Cysteine Peptidase (CASP8)
NCBI Accession:
NM_033358,NP_203522
Species:
Human
Synonyms:
casp8.L, LOC661095, CASP8, LOC5563818, casp8, LOC100222284, Casp8
Insert length:
708 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5430806
$420.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Caspase 8, Apoptosis-Related Cysteine Peptidase (CASP8)
NCBI Accession:
NM_001080124,NP_001073593
Species:
Human
Synonyms:
casp8.L, LOC661095, CASP8, LOC5563818, casp8, LOC100222284, Casp8
Insert length:
1395 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5430807
$420.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Caspase 8, Apoptosis-Related Cysteine Peptidase (CASP8)
NCBI Accession:
NM_033356,NP_203520
Species:
Human
Synonyms:
casp8.L, LOC661095, CASP8, LOC5563818, casp8, LOC100222284, Casp8
Insert length:
1395 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5430803
$420.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Caspase 8 (CASP8)
NCBI Accession:
NM_001080124
Species:
Human
Synonyms:
casp8.L, LOC661095, CASP8, LOC5563818, casp8, LOC100222284, Casp8
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of CASP8
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5135936
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available
  • <
  • 1

Synonyms and alternative names related to Caspase 8

  • caspase 8 L homeolog (casp8.L)
  • death related ced-3/Nedd2-like protein (LOC661095)
  • caspase 8 (CASP8)
  • caspase-8 (LOC5563818)
  • caspase-8 (casp8)
  • caspase-8-like (LOC100222284)
  • caspase 8 (Casp8)
  • caspase 8, apoptosis-related cysteine peptidase (casp8)
  • ALPS2B
  • CAP4
  • CASP-8
  • Casp-8
  • casp8
  • CASP8
  • casp8-A
  • caspase-8
  • FLICE
  • MACH
  • Mch5
  • MCH5
  • xCaspase-8
  • zgc:92075

Gene-IDs for different species

GENE IDSPECIES
373559 Xenopus laevis
661095 Tribolium castaneum
702781 Macaca mulatta
5563818 Aedes aegypti
100049400 Oryzias latipes
100066502 Equus caballus
100142684 Felis catus
100172115 Pongo abelii
100222284 Taeniopygia guttata
100472842 Ailuropoda melanoleuca
100579132 Hydra magnipapillata
100586183 Nomascus leucogenys
12370 Mus musculus
64044 Rattus norvegicus
100348477 Oryctolagus cuniculus
841 Homo sapiens
746477 Pan troglodytes
507481 Bos taurus
395284 Gallus gallus
488473 Canis lupus familiaris
595105 Sus scrofa
101107334 Ovis aries
58022 Danio rerio

Protein level used designations for Caspase 8

  • caspase-8
  • xcaspase 8
  • death related ced-3/Nedd2-like protein
  • GLEAN_14026
  • caspase 8, apoptosis-related cysteine peptidase
  • caspase 8
  • caspase-8-like
  • DEATH effector domain caspase
  • Fas-linked ICE-like protease
  • FADD-homologous ICE/CED-3-like protease
  • FADD-like ICE
  • ICE-like apoptotic protease 5
  • MACH-alpha-1/2/3 protein
  • MACH-beta-1/2/3/4 protein
  • MORT1-associated ced-3 homolog
  • apoptotic cysteine protease
  • apoptotic protease Mch-5
  • caspase 8, apoptosis-related cysteine protease
  • caspase-8a
  • cysteine protease
Other products related to Caspase 8 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com