Cathepsin H (Cathepsin H, CTSH)

Short Description: The protein encoded by this gene is a lysosomal cysteine proteinase important in the overall degradation of lysosomal proteins. It is composed of a dimer of disulfide-linked heavy and light chains, both produced from a single protein precursor. The encoded protein, which belongs to the peptidase C1 protein family, can act both as an aminopeptidase and as an endopeptidase. Increased expression of this gene has been correlated with malignant progression of prostate tumors. [provided by RefSeq, Mar 2010].
More information related to gene Cathepsin H.
Products related to Cathepsin H Gene:
132 Products
Data Quality
  • 1
Type
  • 124
  • 8
Species
  • 42
  • 42
  • 40
  • 2
  • 2
Application
  • 79
  • 32
  • 26
  • 16
  • 3
Fusion tag
  • 50
  • 16
  • 13
  • 10
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
Vector
  • 58
  • 35
  • 12
  • 9
  • 6
Insert
  • 45
  • 42
  • 21
  • 8
  • 6
Oligo-Type
  • 5
  • 3
Resistance Gene
  • 55
  • 45
  • 20
  • 4
  • 2
Expression Type
  • 94
  • 50
  • 23
Selectable Marker
  • 26
  • 25
  • 23
Promoter
  • 39
  • 31
  • 31
  • 12
  • 8
Format
  • 63
  • 27
  • 22
  • 20

Type:
ORF
Application:
Cloning
Gene:
Cathepsin H (CTSH)
Species:
Human
Synonyms:
ctsh, CTSH, ctsh.L, Ctsh
Insert length:
1008 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5722216
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Cathepsin H (CTSH)
NCBI Accession:
NM_004390,NP_004381
Species:
Human
Synonyms:
ctsh, CTSH, ctsh.L, Ctsh
Insert length:
1008 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5342750
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Cathepsin H (CTSH)
Gene ID:
324818 (Zebrafish (Danio rerio), CTSH)
Synonyms:
ctsh, CTSH, ctsh.L, Ctsh
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6.1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3877066
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Cathepsin H (CTSH)
Gene ID:
510524 (Cow (Bovine), CTSH)
Synonyms:
ctsh, CTSH, ctsh.L, Ctsh
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3856943
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Cathepsin H (CTSH)
Gene ID:
100036949 (Xenopus laevis, CTSH)
Synonyms:
ctsh, CTSH, ctsh.L, Ctsh
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS111
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • Sp6
  • T3
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4033417
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Cathepsin H (CTSH)
Gene ID:
25425 (Rat (Rattus), CTSH)
Synonyms:
ctsh, CTSH, ctsh.L, Ctsh
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4045844
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Cathepsin H (CTSH)
Gene ID:
496748 (Xenopus tropicalis, CTSH)
Synonyms:
ctsh, CTSH, ctsh.L, Ctsh
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4060051
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Cathepsin H (CTSH)
Gene ID:
1512 (Human, CTSH)
Synonyms:
ctsh, CTSH, ctsh.L, Ctsh
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4083919
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Cathepsin H (CTSH)
Gene ID:
13036 (Mouse (Murine), CTSH)
Synonyms:
ctsh, CTSH, ctsh.L, Ctsh
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4214214
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Cathepsin H (CTSH)
NCBI Accession:
NM_007801
Species:
Mouse (Murine)
Synonyms:
ctsh, CTSH, ctsh.L, Ctsh
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3558975
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Cathepsin H (CTSH)
NCBI Accession:
NM_012939
Species:
Rat (Rattus)
Synonyms:
ctsh, CTSH, ctsh.L, Ctsh
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3558976
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Cathepsin H
Species:
Mouse (Murine)
Synonyms:
fc44c02, zgc:85774, wu:fc44c02, CTSH, ACC-4, ACC-5, CPSB, minichain, AL022844
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3194160
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
Cathepsin H
Species:
Rat (Rattus)
Synonyms:
fc44c02, zgc:85774, wu:fc44c02, CTSH, ACC-4, ACC-5, CPSB, minichain, AL022844
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3197011
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
Cathepsin H
Species:
Human
Synonyms:
fc44c02, zgc:85774, wu:fc44c02, CTSH, ACC-4, ACC-5, CPSB, minichain, AL022844
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3193065
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Cathepsin H (CTSH)
Gene ID:
324818 (Zebrafish (Danio rerio), CTSH)
Synonyms:
ctsh, CTSH, ctsh.L, Ctsh
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3840703
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Cathepsin H (CTSH)
Gene ID:
510524 (Cow (Bovine), CTSH)
Synonyms:
ctsh, CTSH, ctsh.L, Ctsh
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3856942
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Cathepsin H (CTSH)
Gene ID:
100036949 (Xenopus laevis, CTSH)
Synonyms:
ctsh, CTSH, ctsh.L, Ctsh
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS111
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • Sp6
  • T3
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4033416
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Cathepsin H (CTSH)
Gene ID:
25425 (Rat (Rattus), CTSH)
Synonyms:
ctsh, CTSH, ctsh.L, Ctsh
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4045845
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Cathepsin H (CTSH)
Gene ID:
496748 (Xenopus tropicalis, CTSH)
Synonyms:
ctsh, CTSH, ctsh.L, Ctsh
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4060052
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Cathepsin H (CTSH)
Gene ID:
1512 (Human, CTSH)
Synonyms:
ctsh, CTSH, ctsh.L, Ctsh
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4083920
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
  • <
  • 1

Synonyms and alternative names related to Cathepsin H

  • cathepsin H (ctsh)
  • cathepsin H (CTSH)
  • cathepsin H L homeolog (ctsh.L)
  • cathepsin H (Ctsh)
  • ACC-4
  • ACC-5
  • AL022844
  • CPSB
  • CTSH
  • fc44c02
  • minichain
  • wu:fc44c02
  • zgc:85774

Gene-IDs for different species

GENE IDSPECIES
324818 Danio rerio
496748 Xenopus (Silurana) tropicalis
711437 Macaca mulatta
740462 Pan troglodytes
770109 Gallus gallus
100036949 Xenopus laevis
100101597 Oryctolagus cuniculus
100413104 Callithrix jacchus
100584322 Nomascus leucogenys
1512 Homo sapiens
13036 Mus musculus
25425 Rattus norvegicus
479065 Canis lupus familiaris
396969 Sus scrofa
510524 Bos taurus

Protein level used designations for Cathepsin H

  • cathepsin H
  • cathepsin H-like
  • N-benzoylarginine-beta-naphthylamide hydrolase
  • aleurain
  • cathepsin B3
  • cathepsin BA
  • pro-cathepsin H
  • Cat H
Other products related to Cathepsin H such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com